ID: 1193903873

View in Genome Browser
Species Human (GRCh38)
Location X:87219016-87219038
Sequence TTAAATGTAAGATCAGCTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193903872_1193903873 -10 Left 1193903872 X:87219003-87219025 CCAGATAGTGAAATTAAATGTAA No data
Right 1193903873 X:87219016-87219038 TTAAATGTAAGATCAGCTAAAGG No data
1193903870_1193903873 6 Left 1193903870 X:87218987-87219009 CCAAGTATCTTTTTTCCCAGATA No data
Right 1193903873 X:87219016-87219038 TTAAATGTAAGATCAGCTAAAGG No data
1193903871_1193903873 -9 Left 1193903871 X:87219002-87219024 CCCAGATAGTGAAATTAAATGTA No data
Right 1193903873 X:87219016-87219038 TTAAATGTAAGATCAGCTAAAGG No data
1193903869_1193903873 7 Left 1193903869 X:87218986-87219008 CCCAAGTATCTTTTTTCCCAGAT No data
Right 1193903873 X:87219016-87219038 TTAAATGTAAGATCAGCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193903873 Original CRISPR TTAAATGTAAGATCAGCTAA AGG Intergenic
No off target data available for this crispr