ID: 1193913005

View in Genome Browser
Species Human (GRCh38)
Location X:87328141-87328163
Sequence CTGTAGCAGCAGAGGCAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193913005_1193913012 9 Left 1193913005 X:87328141-87328163 CCCTTCTGCCTCTGCTGCTACAG No data
Right 1193913012 X:87328173-87328195 CCCTCTTTGCTACCAGTCTGGGG No data
1193913005_1193913009 7 Left 1193913005 X:87328141-87328163 CCCTTCTGCCTCTGCTGCTACAG No data
Right 1193913009 X:87328171-87328193 TGCCCTCTTTGCTACCAGTCTGG No data
1193913005_1193913014 13 Left 1193913005 X:87328141-87328163 CCCTTCTGCCTCTGCTGCTACAG No data
Right 1193913014 X:87328177-87328199 CTTTGCTACCAGTCTGGGGAAGG No data
1193913005_1193913010 8 Left 1193913005 X:87328141-87328163 CCCTTCTGCCTCTGCTGCTACAG No data
Right 1193913010 X:87328172-87328194 GCCCTCTTTGCTACCAGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193913005 Original CRISPR CTGTAGCAGCAGAGGCAGAA GGG (reversed) Intergenic
No off target data available for this crispr