ID: 1193913045

View in Genome Browser
Species Human (GRCh38)
Location X:87328351-87328373
Sequence CAGAAAAATCAGGTGGAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193913045_1193913049 4 Left 1193913045 X:87328351-87328373 CCCAACTCCACCTGATTTTTCTG No data
Right 1193913049 X:87328378-87328400 GCAATAGTTCTCTGTCCCTCTGG No data
1193913045_1193913050 9 Left 1193913045 X:87328351-87328373 CCCAACTCCACCTGATTTTTCTG No data
Right 1193913050 X:87328383-87328405 AGTTCTCTGTCCCTCTGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193913045 Original CRISPR CAGAAAAATCAGGTGGAGTT GGG (reversed) Intergenic
No off target data available for this crispr