ID: 1193914801

View in Genome Browser
Species Human (GRCh38)
Location X:87351922-87351944
Sequence AACAGCTCTTGGCCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193914801_1193914804 11 Left 1193914801 X:87351922-87351944 CCAGTAACAGGCCAAGAGCTGTT No data
Right 1193914804 X:87351956-87351978 GAGTAGTTATCTGCAGAAGATGG 0: 178
1: 192
2: 102
3: 110
4: 247
1193914801_1193914805 16 Left 1193914801 X:87351922-87351944 CCAGTAACAGGCCAAGAGCTGTT No data
Right 1193914805 X:87351961-87351983 GTTATCTGCAGAAGATGGCAAGG 0: 180
1: 172
2: 120
3: 86
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193914801 Original CRISPR AACAGCTCTTGGCCTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr