ID: 1193916650

View in Genome Browser
Species Human (GRCh38)
Location X:87372752-87372774
Sequence AAATGGCAACAGATCGATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193916647_1193916650 17 Left 1193916647 X:87372712-87372734 CCATTTCACATGCAATGATACAT No data
Right 1193916650 X:87372752-87372774 AAATGGCAACAGATCGATCAAGG No data
1193916646_1193916650 18 Left 1193916646 X:87372711-87372733 CCCATTTCACATGCAATGATACA No data
Right 1193916650 X:87372752-87372774 AAATGGCAACAGATCGATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193916650 Original CRISPR AAATGGCAACAGATCGATCA AGG Intergenic
No off target data available for this crispr