ID: 1193927068

View in Genome Browser
Species Human (GRCh38)
Location X:87500487-87500509
Sequence GTCCATGTTCAACATAGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193927068_1193927069 5 Left 1193927068 X:87500487-87500509 CCAACACTATGTTGAACATGGAC No data
Right 1193927069 X:87500515-87500537 GTCTAAAACACCAAAAGCAATGG 0: 9694
1: 7889
2: 2856
3: 966
4: 781

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193927068 Original CRISPR GTCCATGTTCAACATAGTGT TGG (reversed) Intergenic
No off target data available for this crispr