ID: 1193927069

View in Genome Browser
Species Human (GRCh38)
Location X:87500515-87500537
Sequence GTCTAAAACACCAAAAGCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 22186
Summary {0: 9694, 1: 7889, 2: 2856, 3: 966, 4: 781}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193927066_1193927069 14 Left 1193927066 X:87500478-87500500 CCAGAACTTCCAACACTATGTTG 0: 8658
1: 4974
2: 3041
3: 1678
4: 1143
Right 1193927069 X:87500515-87500537 GTCTAAAACACCAAAAGCAATGG 0: 9694
1: 7889
2: 2856
3: 966
4: 781
1193927068_1193927069 5 Left 1193927068 X:87500487-87500509 CCAACACTATGTTGAACATGGAC No data
Right 1193927069 X:87500515-87500537 GTCTAAAACACCAAAAGCAATGG 0: 9694
1: 7889
2: 2856
3: 966
4: 781
1193927063_1193927069 28 Left 1193927063 X:87500464-87500486 CCTAATTGCCCTGGCCAGAACTT 0: 3736
1: 7859
2: 4411
3: 3058
4: 3309
Right 1193927069 X:87500515-87500537 GTCTAAAACACCAAAAGCAATGG 0: 9694
1: 7889
2: 2856
3: 966
4: 781
1193927065_1193927069 19 Left 1193927065 X:87500473-87500495 CCTGGCCAGAACTTCCAACACTA 0: 8613
1: 4966
2: 2819
3: 1420
4: 927
Right 1193927069 X:87500515-87500537 GTCTAAAACACCAAAAGCAATGG 0: 9694
1: 7889
2: 2856
3: 966
4: 781
1193927064_1193927069 20 Left 1193927064 X:87500472-87500494 CCCTGGCCAGAACTTCCAACACT 0: 8867
1: 4809
2: 2628
3: 1296
4: 844
Right 1193927069 X:87500515-87500537 GTCTAAAACACCAAAAGCAATGG 0: 9694
1: 7889
2: 2856
3: 966
4: 781

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193927069 Original CRISPR GTCTAAAACACCAAAAGCAA TGG Intergenic
Too many off-targets to display for this crispr