ID: 1193928370

View in Genome Browser
Species Human (GRCh38)
Location X:87520082-87520104
Sequence ATGGTTTTATAGGTGTGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 125}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193928370 Original CRISPR ATGGTTTTATAGGTGTGCCA AGG Intronic
901392359 1:8955104-8955126 CTGGGATTATAGGTGAGCCACGG - Intronic
903529444 1:24018954-24018976 ATGGTTTTATTTGTGTGCCTTGG + Intergenic
905010955 1:34746815-34746837 TTAGTTCTATAGATGTGCCACGG - Intronic
906262231 1:44402710-44402732 AGGGTTTTAGGGGTGTGACAGGG - Intergenic
907830796 1:58062384-58062406 ATGGTTTTATATGTGGGTCTTGG + Intronic
909565118 1:77045136-77045158 ATGGTGCTGTAGATGTGCCATGG + Intronic
912919910 1:113855951-113855973 ATCATTTTATATGTGTGCCATGG + Intronic
914351657 1:146845132-146845154 ATGGTTTTGTGGGTGGCCCAGGG - Intergenic
914461428 1:147889464-147889486 ATGGGTTTACAGGTAGGCCAAGG + Intergenic
918245201 1:182653226-182653248 ATGGGGTTCTAGGTGTCCCATGG + Intronic
919227748 1:194729669-194729691 ATGGTATTATAAGTGTTCCCAGG + Intergenic
924393971 1:243596823-243596845 ATGGTGGTATAGCTGTGCAAAGG + Intronic
1062899510 10:1132043-1132065 ATGCATTTATAAGTGTTCCATGG + Exonic
1062916062 10:1241952-1241974 GCGGCTTTATTGGTGTGCCAGGG + Intronic
1064566883 10:16648873-16648895 ATGCTTTTATAGTTGTGACTTGG - Intronic
1065801269 10:29355340-29355362 CTTGTTACATAGGTGTGCCATGG + Intergenic
1066500826 10:35992816-35992838 AAGATTTTAAAGGTGTGCAAAGG + Intergenic
1066628718 10:37437083-37437105 AAGATTTTAAAGGTGTGCAAAGG + Intergenic
1067911269 10:50349373-50349395 ATGGTCTTATGTGTGTGCTATGG + Intronic
1070587583 10:77778550-77778572 ATGCTTTTATATGTTTGCCCAGG - Intergenic
1074278349 10:112026126-112026148 ATGTACTTAGAGGTGTGCCATGG - Intergenic
1074302924 10:112249279-112249301 ATGGTTAGATAGGTTTTCCAAGG + Intergenic
1075581501 10:123622060-123622082 ATGTTTTTATATGTGGGACATGG - Intergenic
1075676585 10:124300062-124300084 ATGGATTTCTAGGTGAGCAATGG + Intergenic
1080770596 11:35337595-35337617 ATGGTATAACAGGTGTACCATGG + Intronic
1081978329 11:47249821-47249843 CTGGTATTACAGGTGAGCCACGG - Intronic
1086916407 11:92534493-92534515 TTTGTTTTATAGGTGTGTTAGGG + Intronic
1087585247 11:100111066-100111088 ATGTTTATATAGGTTTACCAAGG + Intronic
1091213792 11:133887081-133887103 ATGTTTTCATAGGTGTGGGAGGG - Intergenic
1092511020 12:9156980-9157002 TTTGTTACATAGGTGTGCCATGG + Intronic
1093560043 12:20527612-20527634 AATGTTTTACAGGTTTGCCACGG - Intronic
1095594117 12:43939510-43939532 AAGGTTTTATAGGAGTTCCAGGG + Intronic
1105757444 13:23481267-23481289 ATGGTTTTATAAGTGTGTGATGG + Intergenic
1107581704 13:41795888-41795910 TTTGTTACATAGGTGTGCCATGG - Intronic
1108791348 13:53972643-53972665 AAGGTCTTATGGGGGTGCCAGGG - Intergenic
1109535141 13:63706876-63706898 TTGGTTTTATAGATTTGCCATGG - Intergenic
1110018300 13:70436929-70436951 ATGGTTTTATAAGTGTTTGATGG - Intergenic
1113075371 13:106462857-106462879 ATGGTTTTATAGGTAGCCTAAGG - Intergenic
1113514015 13:110877158-110877180 ATATTTTCATAGGTATGCCATGG + Intergenic
1119616285 14:76101078-76101100 ATGCTTTCATAGGTGCTCCATGG + Intergenic
1120529464 14:85614646-85614668 GTGGTTTCATAGGTCTGCAAAGG - Intronic
1121829991 14:97043208-97043230 AGGGTTTTCTGGGTGAGCCAAGG - Intergenic
1125385574 15:39132914-39132936 AAAGTTTCAGAGGTGTGCCAAGG + Intergenic
1128488965 15:68126732-68126754 ATTGTTTTATAGTTGTACCATGG + Intronic
1132311888 15:100863229-100863251 ATGGTTTTCCAGGGATGCCAGGG - Intergenic
1132509868 16:334165-334187 GTGCTGTTATTGGTGTGCCATGG - Intronic
1135248670 16:20881132-20881154 ATGGCTTTATATGTGTGCATTGG - Intronic
1138238027 16:55402048-55402070 ATGCTGTTATAGGTGGGACATGG + Intronic
1139982378 16:70870404-70870426 ATGGTTTTGTGGGTGGCCCAGGG + Intronic
1144141069 17:12348464-12348486 ATGGGTCTATATGTGAGCCATGG + Intergenic
1145124355 17:20287851-20287873 TTTGTTACATAGGTGTGCCATGG + Intronic
1146964900 17:37017951-37017973 ATGATTTTGTAGGTGAGGCATGG - Intronic
1147438766 17:40433992-40434014 ATGGGTTTATAGGGTTACCATGG + Intergenic
1150901868 17:69288099-69288121 ATGGTTTTATAGTAGTTCAAGGG + Intronic
1153208666 18:2734239-2734261 GTGGTTTAATAGTGGTGCCAGGG + Intronic
1153367459 18:4273419-4273441 ATGGTTGTAATGCTGTGCCATGG - Intronic
1157790794 18:50529271-50529293 ATGGTTTTATAGGCATGGAAGGG - Intergenic
1159768608 18:72521471-72521493 ATGGTTTTATATCTGTGTGATGG + Intergenic
1165209593 19:34223354-34223376 CTGGGTTTATAGGTGTGCCATGG + Intronic
927352594 2:22134972-22134994 ATGGTTTTAAATGTTTGTCAGGG - Intergenic
929520354 2:42644493-42644515 ATGCTATTATAGGTGTGGCCTGG + Intronic
933311950 2:80671684-80671706 ATGGTTTGATACTTGTACCAAGG - Intergenic
935600621 2:104918307-104918329 ATTGTATTATAGGTATGTCAAGG - Intergenic
938632396 2:133181147-133181169 ATGGTTCTAAATGTGTGTCAAGG + Intronic
940815165 2:158289741-158289763 ATGTTTTTATATGTGTTCCCTGG - Intronic
1168786768 20:546056-546078 AGGGTTGTATATGTGTGCCCAGG - Intergenic
1171215061 20:23346324-23346346 ATGGTGTTACATGTCTGCCAAGG - Intergenic
1172308075 20:33895926-33895948 ATGGGTTTATAGGTGAGGGATGG + Intergenic
1177220363 21:18184815-18184837 ATGGTTTTCAAGCTGTGCCTAGG - Intronic
1177745926 21:25213044-25213066 ATGGTTTTATAGGAGAGCATTGG - Intergenic
1184147707 22:42621049-42621071 ATAGTTTTATAGCTGGGCAATGG + Intronic
951634901 3:24763135-24763157 AAGCTTTTATAGGTTTCCCATGG - Intergenic
955195712 3:56802928-56802950 ATGGGTCTATGGGTGTGGCATGG + Intronic
957937000 3:86957022-86957044 TTTGTTTTATATGAGTGCCAGGG + Intronic
959650260 3:108744357-108744379 ATGATTATTTAGGTGTGGCAAGG - Intronic
964166079 3:153706692-153706714 ATGGTCTTGTATGTGTGCCCTGG - Intergenic
964524868 3:157607564-157607586 CTGATTTTATAGGTCTGCAATGG + Intronic
965225802 3:165988082-165988104 ATGGGTTTAGATATGTGCCATGG + Intergenic
965383703 3:168021215-168021237 AAGATATTATGGGTGTGCCAGGG + Intronic
967201737 3:187077857-187077879 ATGGTTTCTTGGGTGTTCCAAGG - Exonic
969356370 4:6629008-6629030 CTGGATTTCTAGGTGTGGCATGG + Intergenic
972446543 4:39149630-39149652 ATGGGTTGATAGGTGCACCATGG + Intergenic
974353537 4:60782079-60782101 ATGGTTGTATATGACTGCCAGGG + Intergenic
976917668 4:90397939-90397961 TTGGTTGTATTGGTTTGCCAGGG + Intronic
977583549 4:98749779-98749801 ATGGTTTCATAGGTGTACAGTGG + Intergenic
977669801 4:99682906-99682928 AGGGTTTTATAACTGTGCTAAGG - Intergenic
980066116 4:128190597-128190619 ATGGTTTTATAAGTGTTTGACGG + Intronic
981141492 4:141274763-141274785 CTGGTTTTAGAATTGTGCCAGGG + Intergenic
982226050 4:153167661-153167683 ATAGTTTTATACTTGTCCCAGGG - Intronic
983673082 4:170260351-170260373 ATGATTTTCTAGCTCTGCCATGG - Intergenic
983726099 4:170927936-170927958 GTGGTTTTATAGGAGGGGCATGG - Intergenic
983910855 4:173237104-173237126 ATGGATTTCTAGTCGTGCCATGG + Intronic
984273774 4:177582208-177582230 ATGGTTTTATAACCTTGCCAAGG - Intergenic
990001666 5:50900543-50900565 TTGTTTTTATAGTTGTTCCATGG + Intergenic
993403566 5:87483657-87483679 ATGGTTTTATAGGTGTATACTGG - Intergenic
993774987 5:91982442-91982464 ATCCTTTAATAAGTGTGCCAGGG - Intergenic
994152401 5:96462838-96462860 ATGGTTTTATAAGTGTTCGGCGG + Intergenic
994727474 5:103453615-103453637 AAGCTTTAATAGGGGTGCCAAGG + Intergenic
996302327 5:122003383-122003405 ATGGTTTTAAATGTGTGCTCAGG + Intronic
996506050 5:124268740-124268762 ATGGGTTGATAGGTGCACCATGG - Intergenic
1003092240 6:3114069-3114091 ATGGATTTAAAGGGGTACCAAGG + Exonic
1003797519 6:9621505-9621527 AAGGTTTTATATGCGTGCAAAGG - Intronic
1007912695 6:45531776-45531798 ATGGTTTTATATGTGGGGCGAGG + Intronic
1013695952 6:112703452-112703474 ATGGTTTTATATTTTTGCAAAGG + Intergenic
1015299163 6:131633200-131633222 ATGGTTTTATAAGTGTTTGACGG + Intronic
1019108072 6:169684986-169685008 ATGGTTGTGTAGCTTTGCCAAGG - Intronic
1022039947 7:26571650-26571672 ATTGTTTTATATTTGTACCAAGG + Intergenic
1025640547 7:63363551-63363573 ATGGTTTTTGAGGTGTGACTGGG + Intergenic
1025642152 7:63384542-63384564 ATGGTTTTTGAGGTGTGACTGGG - Intergenic
1028979753 7:96954287-96954309 AGGGATTTATTGATGTGCCAAGG - Intergenic
1031849956 7:126851575-126851597 ATGATTTTCTAGGTGTTCAAAGG - Intronic
1032820643 7:135521182-135521204 CTGGGACTATAGGTGTGCCAGGG - Intergenic
1034476790 7:151289432-151289454 ATGGTTATTTAGGTGTGGAAAGG + Intergenic
1038712337 8:29959176-29959198 ATGGTTTTATAAGTGTTTGACGG - Intergenic
1041175885 8:55195931-55195953 ATGGTTTTATAGATGTCTCCGGG + Intronic
1044511620 8:93086954-93086976 ATGACTTTTAAGGTGTGCCATGG - Intergenic
1049036198 8:140078277-140078299 GTGGTTTTATAGCAGTGCCATGG + Intronic
1049244537 8:141555085-141555107 ATGGTGTTGGAGGTGTGTCATGG + Intergenic
1049244552 8:141555182-141555204 ATGGTGTTGGAGGTGTGTCATGG + Intergenic
1049244566 8:141555260-141555282 ATGGTGTTGGAGGTGTGTCATGG + Intergenic
1051589349 9:18760520-18760542 AGGTATTAATAGGTGTGCCATGG - Intronic
1052311620 9:27074792-27074814 CTGGTTTGATAGCTGTGGCAGGG + Intergenic
1053184299 9:36002431-36002453 ATGGTTTTCTACGTGCTCCATGG + Intergenic
1059291708 9:113231104-113231126 ATGGCTTGATAGGTGTGTCAAGG - Intronic
1188686802 X:33079300-33079322 ATGGTTTTATAGGCCGGGCATGG - Intronic
1189399390 X:40652353-40652375 AATGTTGTATAAGTGTGCCATGG + Intronic
1191688546 X:63917121-63917143 TTGTTTTAACAGGTGTGCCATGG + Intergenic
1193928370 X:87520082-87520104 ATGGTTTTATAGGTGTGCCAAGG + Intronic
1194144138 X:90242612-90242634 ACGGTTTTATATGAGTTCCATGG - Intergenic
1195317947 X:103696929-103696951 ATGATATTACAGGTGTGCAATGG - Intergenic
1195765697 X:108294590-108294612 ATGGTTCTTTATTTGTGCCATGG - Intronic
1197571281 X:128153711-128153733 ATGGGTTGATAGGTGCACCATGG + Intergenic
1198114313 X:133530443-133530465 AAGGTCTTCTAGGTTTGCCAAGG - Intergenic
1198264900 X:134999956-134999978 TTTGTTTTATACGTGTGCCCAGG - Intergenic
1200489902 Y:3811913-3811935 ATGGTTTTATATGAGTTCCATGG - Intergenic
1202099762 Y:21294917-21294939 ATGGTTTTATGGGTGGGTCCAGG - Intergenic