ID: 1193940873

View in Genome Browser
Species Human (GRCh38)
Location X:87679748-87679770
Sequence CGCCTGCAGCCCCAACACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193940873_1193940876 1 Left 1193940873 X:87679748-87679770 CCAAAGTGTTGGGGCTGCAGGCG No data
Right 1193940876 X:87679772-87679794 AGGCCAGCACGCCTGGCCCAAGG No data
1193940873_1193940875 -6 Left 1193940873 X:87679748-87679770 CCAAAGTGTTGGGGCTGCAGGCG No data
Right 1193940875 X:87679765-87679787 CAGGCGTAGGCCAGCACGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193940873 Original CRISPR CGCCTGCAGCCCCAACACTT TGG (reversed) Intergenic
No off target data available for this crispr