ID: 1193946868

View in Genome Browser
Species Human (GRCh38)
Location X:87748448-87748470
Sequence CAGCTTTACAAACTGTACAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193946868_1193946870 24 Left 1193946868 X:87748448-87748470 CCGATGTACAGTTTGTAAAGCTG No data
Right 1193946870 X:87748495-87748517 GATTAAGCTTTAAGTTTAAATGG No data
1193946868_1193946869 -7 Left 1193946868 X:87748448-87748470 CCGATGTACAGTTTGTAAAGCTG No data
Right 1193946869 X:87748464-87748486 AAAGCTGTATTGACATTACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193946868 Original CRISPR CAGCTTTACAAACTGTACAT CGG (reversed) Intergenic
No off target data available for this crispr