ID: 1193947368

View in Genome Browser
Species Human (GRCh38)
Location X:87755075-87755097
Sequence ACTGTTAACTCTGCAATGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193947368_1193947373 -7 Left 1193947368 X:87755075-87755097 CCAAACATTGCAGAGTTAACAGT No data
Right 1193947373 X:87755091-87755113 TAACAGTACCAAGGTTGGTGGGG No data
1193947368_1193947371 -9 Left 1193947368 X:87755075-87755097 CCAAACATTGCAGAGTTAACAGT No data
Right 1193947371 X:87755089-87755111 GTTAACAGTACCAAGGTTGGTGG No data
1193947368_1193947378 20 Left 1193947368 X:87755075-87755097 CCAAACATTGCAGAGTTAACAGT No data
Right 1193947378 X:87755118-87755140 CCCCATTACGGAAAGGTCCAAGG No data
1193947368_1193947375 8 Left 1193947368 X:87755075-87755097 CCAAACATTGCAGAGTTAACAGT No data
Right 1193947375 X:87755106-87755128 TGGTGGGGTATTCCCCATTACGG No data
1193947368_1193947372 -8 Left 1193947368 X:87755075-87755097 CCAAACATTGCAGAGTTAACAGT No data
Right 1193947372 X:87755090-87755112 TTAACAGTACCAAGGTTGGTGGG No data
1193947368_1193947376 13 Left 1193947368 X:87755075-87755097 CCAAACATTGCAGAGTTAACAGT No data
Right 1193947376 X:87755111-87755133 GGGTATTCCCCATTACGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193947368 Original CRISPR ACTGTTAACTCTGCAATGTT TGG (reversed) Intergenic
No off target data available for this crispr