ID: 1193947371

View in Genome Browser
Species Human (GRCh38)
Location X:87755089-87755111
Sequence GTTAACAGTACCAAGGTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193947368_1193947371 -9 Left 1193947368 X:87755075-87755097 CCAAACATTGCAGAGTTAACAGT No data
Right 1193947371 X:87755089-87755111 GTTAACAGTACCAAGGTTGGTGG No data
1193947367_1193947371 -8 Left 1193947367 X:87755074-87755096 CCCAAACATTGCAGAGTTAACAG No data
Right 1193947371 X:87755089-87755111 GTTAACAGTACCAAGGTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193947371 Original CRISPR GTTAACAGTACCAAGGTTGG TGG Intergenic
No off target data available for this crispr