ID: 1193951742

View in Genome Browser
Species Human (GRCh38)
Location X:87808783-87808805
Sequence CCCACGGACGTGGAGAGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193951731_1193951742 12 Left 1193951731 X:87808748-87808770 CCGTGCTTGTGGGGGAGGCTCGG No data
Right 1193951742 X:87808783-87808805 CCCACGGACGTGGAGAGGGGAGG No data
1193951725_1193951742 27 Left 1193951725 X:87808733-87808755 CCATGGAGTAGGGGGCCGTGCTT No data
Right 1193951742 X:87808783-87808805 CCCACGGACGTGGAGAGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193951742 Original CRISPR CCCACGGACGTGGAGAGGGG AGG Intergenic
No off target data available for this crispr