ID: 1193954590

View in Genome Browser
Species Human (GRCh38)
Location X:87844201-87844223
Sequence CTGCTTTCATGGAGGTGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193954584_1193954590 -3 Left 1193954584 X:87844181-87844203 CCAACTGTGGATACCAGCACCTG No data
Right 1193954590 X:87844201-87844223 CTGCTTTCATGGAGGTGACAGGG No data
1193954583_1193954590 -2 Left 1193954583 X:87844180-87844202 CCCAACTGTGGATACCAGCACCT No data
Right 1193954590 X:87844201-87844223 CTGCTTTCATGGAGGTGACAGGG No data
1193954580_1193954590 25 Left 1193954580 X:87844153-87844175 CCTGTGATGTGATCTATCTTCAG 0: 8
1: 190
2: 272
3: 274
4: 320
Right 1193954590 X:87844201-87844223 CTGCTTTCATGGAGGTGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193954590 Original CRISPR CTGCTTTCATGGAGGTGACA GGG Intergenic
No off target data available for this crispr