ID: 1193957298

View in Genome Browser
Species Human (GRCh38)
Location X:87878325-87878347
Sequence GACCCACTTTGTGGTTAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193957298_1193957303 12 Left 1193957298 X:87878325-87878347 CCCATCTAACCACAAAGTGGGTC No data
Right 1193957303 X:87878360-87878382 ATTCCATCATCAAATGGAAGTGG 0: 167
1: 211
2: 137
3: 138
4: 343
1193957298_1193957302 6 Left 1193957298 X:87878325-87878347 CCCATCTAACCACAAAGTGGGTC No data
Right 1193957302 X:87878354-87878376 AGCAGCATTCCATCATCAAATGG 0: 191
1: 182
2: 140
3: 118
4: 243
1193957298_1193957305 22 Left 1193957298 X:87878325-87878347 CCCATCTAACCACAAAGTGGGTC No data
Right 1193957305 X:87878370-87878392 CAAATGGAAGTGGTTGTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193957298 Original CRISPR GACCCACTTTGTGGTTAGAT GGG (reversed) Intergenic
No off target data available for this crispr