ID: 1193957302

View in Genome Browser
Species Human (GRCh38)
Location X:87878354-87878376
Sequence AGCAGCATTCCATCATCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 874
Summary {0: 191, 1: 182, 2: 140, 3: 118, 4: 243}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193957298_1193957302 6 Left 1193957298 X:87878325-87878347 CCCATCTAACCACAAAGTGGGTC No data
Right 1193957302 X:87878354-87878376 AGCAGCATTCCATCATCAAATGG 0: 191
1: 182
2: 140
3: 118
4: 243
1193957301_1193957302 -3 Left 1193957301 X:87878334-87878356 CCACAAAGTGGGTCATGGACAGC No data
Right 1193957302 X:87878354-87878376 AGCAGCATTCCATCATCAAATGG 0: 191
1: 182
2: 140
3: 118
4: 243
1193957299_1193957302 5 Left 1193957299 X:87878326-87878348 CCATCTAACCACAAAGTGGGTCA No data
Right 1193957302 X:87878354-87878376 AGCAGCATTCCATCATCAAATGG 0: 191
1: 182
2: 140
3: 118
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193957302 Original CRISPR AGCAGCATTCCATCATCAAA TGG Intergenic
900434980 1:2625750-2625772 AGCGGCATTCCATCATCAAATGG + Intronic
904179475 1:28655797-28655819 AGCAGCATTCCATTATCAAATGG - Intergenic
904335949 1:29798160-29798182 AGCTGTATTCCATCATCAAATGG + Intergenic
905117007 1:35650860-35650882 AGCTGTAATCCATCATAAAATGG + Intergenic
905354083 1:37368954-37368976 AGCAGCATTCCATCATCAAATGG + Intergenic
905465244 1:38148273-38148295 AGCAGCATTGCATCATCAAATGG + Intergenic
906050508 1:42867588-42867610 AGCAGCATTCCATCATCAAATGG + Intergenic
906879688 1:49576637-49576659 AGCAGCGTTCCATCATCAAATGG + Intronic
907595735 1:55718274-55718296 ATCAGCACTCTACCATCAAATGG - Intergenic
907597363 1:55732304-55732326 AGCAGAATTCCATCATCAAATGG + Intergenic
907608542 1:55844170-55844192 AGCAGTAATCCATCAAAAAATGG - Intergenic
907780359 1:57561008-57561030 AGCAGCATTCCATCATCAAATGG + Intronic
908052330 1:60246884-60246906 AGCAGCATTCCTTCATCAAATGG + Intergenic
908586480 1:65575709-65575731 AAAACCATTCCATCATTAAAGGG + Intronic
908737408 1:67290987-67291009 AGCAGCATTCCATCATGAAATGG + Intergenic
909172590 1:72315292-72315314 AGCAGCATTCCATCATCAAATGG - Intergenic
909233425 1:73120477-73120499 AGCAGCACTCCTTCATCAAATGG + Intergenic
909481254 1:76130605-76130627 AGGAGGGTTCCATCATCAAATGG - Intronic
909542280 1:76804369-76804391 AGCAGCAATCCATCTTAAATTGG + Intergenic
909548930 1:76877009-76877031 AGCAACATCCCATCATCAAATGG - Intronic
909576939 1:77186032-77186054 AGCAGCATTCCATCATCAAATGG + Intronic
910141302 1:84030153-84030175 AGTAGTACTCCATCATCAAATGG + Intergenic
910370655 1:86512302-86512324 AGCAGCATTCCATCATCAAATGG + Intergenic
910561917 1:88600155-88600177 AGCAGCATTCCATCATCAGATGG + Intergenic
910565659 1:88639893-88639915 AGCAACATTTCATTATTAAATGG - Intergenic
910588230 1:88901896-88901918 AGCAGCATTCCATCATCAAATGG + Intergenic
910630240 1:89346426-89346448 AGCAGCATTCCGTCATCAAATGG + Intergenic
910638969 1:89439800-89439822 AGCAGCATTCCACCATCAAATGG - Intergenic
910790341 1:91043894-91043916 AGCAGTATTCCATCATCAAATGG + Intergenic
910831075 1:91463250-91463272 AGCAGCATTCCATCATCAAATGG - Intergenic
910900632 1:92116560-92116582 AGCAACATTTCATAATAAAAAGG - Intronic
910948234 1:92616882-92616904 AGCAGCACTCCATCATCAAATGG + Intronic
911257305 1:95647190-95647212 AGCAGCATTCCATCATCTAATGG - Intergenic
911738379 1:101361745-101361767 AGCAGCATTCCATCACCAAATGG - Intergenic
911883591 1:103270628-103270650 AGCAGCATTCCATCATCAAATGG + Intergenic
911974276 1:104471874-104471896 AGCAGCACTCCATCATCAAATGG + Intergenic
911980445 1:104559595-104559617 AGCAGCATTCCATCATCATATGG + Intergenic
911981882 1:104579088-104579110 AGCAGCATTCCTTCATCAAATGG - Intergenic
912067042 1:105757129-105757151 AGCAGCATTCCATCACCAAATGG + Intergenic
912129894 1:106587876-106587898 AGCAGCATTCCATTATCAAATGG - Intergenic
912252010 1:108021214-108021236 AGCAGCATTGCATCATCAAATGG - Intergenic
912943794 1:114068033-114068055 AGCAGCATTCCATCATCAAATGG - Intergenic
913039428 1:115008226-115008248 AGCAGCACTCCATCATCAAATGG - Intergenic
913949342 1:143210379-143210401 AACTGAATTCCATCATCGAAAGG - Intergenic
915641108 1:157227306-157227328 AACAGCATTTTATCATCAAGTGG - Intergenic
915667655 1:157459469-157459491 AGCAGCATTCCATCATCAAATGG - Intergenic
915668384 1:157465642-157465664 AACAGCATTTCATCATCAAGTGG + Intergenic
916017339 1:160761827-160761849 AGCAATAGTCCATCATCAGATGG - Intergenic
916089286 1:161294601-161294623 AGCAGCAATTTATCATTAAATGG + Intergenic
916285338 1:163099702-163099724 ATCAGTATTCCATCATCAAATGG + Intergenic
916317165 1:163462207-163462229 AGCAGCACTCCATCATGAAATGG + Intergenic
916380923 1:164209778-164209800 AGAAGCACTCCATCATCAAATGG + Intergenic
916872516 1:168932304-168932326 ACAAGCATTCCATCATCTAGTGG + Intergenic
917052470 1:170939663-170939685 GGCAGTACTCCATCATCAAATGG - Intronic
917217196 1:172690738-172690760 AGCAGCATTCCATCATCAGATGG - Intergenic
917276518 1:173337367-173337389 AGCAGCACTCTATCATCAAAGGG + Intergenic
917283257 1:173399105-173399127 AGCAGCACTCCATCATCAGACGG + Intergenic
917462725 1:175246337-175246359 AGTAGCATTCCATCATCAAATGG + Intergenic
917476023 1:175369793-175369815 AGCAACATTCCTTTAACAAATGG + Intronic
918774511 1:188610921-188610943 AGCAGCATTCCATCATCAAATGG + Intergenic
918783453 1:188732408-188732430 AGCAGCATTCCATCATCAAATGG - Intergenic
918815096 1:189171402-189171424 AACAGCATTCTATAATCAAATGG + Intergenic
918857610 1:189779169-189779191 AGTAGCATCCCATCATTAAATGG + Intergenic
918918214 1:190671705-190671727 AGCAGCATTCCATCATCAAATGG - Intergenic
919124597 1:193379607-193379629 AGCAGCATTCCATCATCAAATGG - Intergenic
919241791 1:194924378-194924400 AGCAGCATTCCATCATCAAATGG + Intergenic
919242122 1:194927667-194927689 AGCAGCATTCCATCATCAAATGG + Intergenic
919320653 1:196032603-196032625 AACAGCAGTCCATTATCAAATGG - Intergenic
919557665 1:199080086-199080108 ATCAACATTCCATAAACAAAAGG - Intergenic
920197452 1:204238540-204238562 AGCAGCATTCCATCATCAAATGG + Intronic
920592720 1:207236691-207236713 AGAAGAATTCCATCAACACAAGG - Intergenic
921619832 1:217313312-217313334 AGCAGCACTCTGTCATCAAATGG + Intergenic
921986350 1:221317093-221317115 AGCAGCACTCCATCTTCAAGTGG + Intergenic
922781032 1:228252407-228252429 AACAGCATTCTATCATCAAATGG - Intronic
923253549 1:232199264-232199286 AGCAGCATTCCATCATCAAATGG - Intergenic
924840759 1:247707658-247707680 AGCAGCATTCCATCATCAACTGG - Intergenic
1063941332 10:11133111-11133133 AGCATCATTTCATCGTAAAATGG + Intronic
1064168304 10:13005412-13005434 AGCAGCAATCTACCATTAAATGG - Intronic
1064517626 10:16168082-16168104 AGCAACATTCCATTATCAAGTGG - Intergenic
1064519659 10:16187861-16187883 ATCAGTACTCCTTCATCAAATGG + Intergenic
1064545672 10:16447961-16447983 AGCAGCATTCCATCATCAAATGG - Intronic
1064784380 10:18877806-18877828 AGCAGCACTCCATCATCAAATGG + Intergenic
1065453530 10:25882901-25882923 AGCCACATTCCATTATCGAATGG + Intergenic
1065701246 10:28427513-28427535 AGAAGCAGTCCATTATCAAGTGG + Intergenic
1066167012 10:32799056-32799078 AGCAGCATTCCATCATCAAATGG - Intronic
1066169447 10:32826492-32826514 AGCAGTATTCCATCATCAAATGG + Intronic
1066957636 10:42188226-42188248 AGCAGCATTCCATCATCAAATGG + Intergenic
1067125534 10:43512370-43512392 AGCAGCATTCCATCATCAAACGG - Intergenic
1067333154 10:45340391-45340413 AGCAGCATTCCATCATCAAATGG + Intergenic
1067754335 10:48993545-48993567 AGCAGCATTCCATCATCAAGTGG - Intergenic
1068007652 10:51409404-51409426 AGCAGCATTCAATCATCGAACGG - Intronic
1068856694 10:61805184-61805206 AGAAACATTCCATCATCAAATGG + Intergenic
1069010446 10:63365986-63366008 AGAAGAATTCCATAATGAAATGG + Intronic
1069192287 10:65506196-65506218 AGCAGCATTCCATCATCGAATGG - Intergenic
1069250206 10:66257569-66257591 AGAAGTATTCCAACTTCAAATGG - Intronic
1069736116 10:70655554-70655576 AGGAGCATTCCACCAGTAAAAGG - Intergenic
1069790810 10:71019409-71019431 AGTAGCATTCCATCATCAAATGG - Intergenic
1071267064 10:83973828-83973850 AGCAGCATTCCATCATCAAATGG - Intergenic
1071361496 10:84850791-84850813 AGGGGCATTCCAGCATTAAAAGG - Intergenic
1071364454 10:84884348-84884370 AGCAGCATTCCATCATCAAATGG - Intergenic
1071378401 10:85033531-85033553 AGCAGCATTCCATCATCAAATGG + Intergenic
1071937707 10:90549449-90549471 AGCAGCATTCCATCATCAAATGG + Intergenic
1071942763 10:90607604-90607626 AGCAGCATTCCATCATGAAATGG - Intergenic
1072209242 10:93231509-93231531 CACAGCCTTCCACCATCAAATGG - Intergenic
1073557367 10:104466074-104466096 AGCAACATTTTATCATCAAATGG + Intergenic
1073656663 10:105424318-105424340 AGCAGCATTCCATCATCAAACGG - Intergenic
1073918460 10:108432141-108432163 AACAGCATTCCATCATCGAGTGG - Intergenic
1073949250 10:108787108-108787130 AGAAGCAATCCAACTTCAAATGG + Intergenic
1073957666 10:108891496-108891518 AGCAGCATTCCATCCTCAAATGG - Intergenic
1073995855 10:109314544-109314566 AGCAGCATTCCATCATCAAGTGG - Intergenic
1074235639 10:111581935-111581957 AGCAGCACTCCATTATCAGATGG - Intergenic
1074911762 10:117916731-117916753 AAAAGCAATCCACCATCAAAGGG + Intergenic
1076429894 10:130394479-130394501 AGCAACATTCCACCAGCAAAGGG + Intergenic
1076579655 10:131498719-131498741 AGCAGCATTGCTAAATCAAAAGG - Intergenic
1076772611 10:132674665-132674687 AGCAGCATTCCATCATCAAATGG - Intronic
1076927397 10:133499052-133499074 AGCAGCATTCCGTCATCAAATGG - Intergenic
1077669480 11:4144725-4144747 AGTAGCAGTCCATCATCAAATGG + Intergenic
1079433898 11:20425413-20425435 AGCAGAATTGCTCCATCAAATGG - Intronic
1079670107 11:23158549-23158571 AGCAGCATTCCATCATGAAATGG - Intergenic
1080020124 11:27551492-27551514 AGCAACACTCTATCATCAAGTGG - Intergenic
1080076612 11:28157664-28157686 AGGAGCATTCCATCATCAAATGG + Intronic
1080235208 11:30060235-30060257 AGTGGCATTCCAACATGAAAAGG - Intergenic
1080976694 11:37350746-37350768 AGCATCACTCCATCATCAAACGG + Intergenic
1081065442 11:38534728-38534750 TGGAGCATTCCATCATCAAATGG - Intergenic
1081072798 11:38631269-38631291 AGCAGCATTCCATCATCAAATGG + Intergenic
1081110495 11:39128567-39128589 AGCAGCATTCCATCATCAAATGG + Intergenic
1081378304 11:42386091-42386113 AGCTGCATTCCGTCATCAAATGG + Intergenic
1081609077 11:44548026-44548048 AGCAGCATTCCATCATCAAATGG + Intergenic
1082668313 11:56003375-56003397 AGCAGAATCCCAGCATCAGATGG + Intergenic
1082671717 11:56043190-56043212 AGCAGCATTCCATCATCAAATGG + Intergenic
1082920271 11:58485249-58485271 AGTAGTACTCCATCATCAAATGG + Intergenic
1082932222 11:58620229-58620251 TGCAGCATCCCTTTATCAAAAGG - Exonic
1082999678 11:59280027-59280049 AGCAGCATTCCATCATCAAATGG + Intergenic
1083011234 11:59401727-59401749 TGCATCATTCTATCATAAAAAGG + Intergenic
1083093161 11:60221274-60221296 AGCAGCATTCCATCATCAAATGG + Intronic
1085685976 11:78622338-78622360 AGCAGCATTCTATCATCAAGTGG + Intergenic
1085747587 11:79128388-79128410 AGCAGCATTCCATCATCAAAAGG + Intronic
1086141617 11:83506036-83506058 AGCAGCATTCCATCAGCAAATGG - Intronic
1086278626 11:85160600-85160622 AGCAGCATTCCATCAGCAAATGG + Intronic
1086643430 11:89188573-89188595 AGCAGTATCCCATCATTAGATGG - Intronic
1086834134 11:91600539-91600561 AGCAGCATTTCAGCCTCAAATGG + Intergenic
1086931906 11:92702769-92702791 AGAAGCATTTCAAGATCAAAAGG - Intronic
1087021590 11:93608583-93608605 AGCAACACTCCTTCATCAGATGG - Intergenic
1087374038 11:97320701-97320723 AGCAGCATTCCATCATCGAATGG + Intergenic
1087398004 11:97627014-97627036 AGCATCATCCTGTCATCAAATGG + Intergenic
1088191639 11:107234342-107234364 AGCAGCATTCCATCATCAAATGG - Intergenic
1088265436 11:107983759-107983781 AGCAGCATTCCATCATCAAATGG + Intergenic
1088355665 11:108941562-108941584 AACATCATTTCACCATCAAAAGG + Intergenic
1088407594 11:109498514-109498536 AGCAGCATTCCATCATCAAATGG - Intergenic
1088449372 11:109965516-109965538 AGCAGCATTCCATCATTAAATGG + Intergenic
1088836672 11:113583537-113583559 AGCAGCATTCCACCATCAAATGG + Intergenic
1089060933 11:115625660-115625682 AGCAGCATTGTAGCATCAAGCGG - Intergenic
1089220250 11:116864699-116864721 AGCAGCATTCCAGTAGCAGATGG + Intronic
1089903626 11:122013757-122013779 AGCAGAATTCCATCATTAGATGG + Intergenic
1090209475 11:124907902-124907924 AGCAGTATTCCAAAATCAAATGG - Intergenic
1090221600 11:125031451-125031473 AGCAGCATTCCATCATCAAATGG - Intronic
1090753968 11:129772441-129772463 CACAGCACTCCATCATCAAATGG - Intergenic
1090994215 11:131850675-131850697 AGCAGCAATCAATGTTCAAAGGG + Intronic
1091051757 11:132378904-132378926 AGCAGCATTCCATCATCAAATGG + Intergenic
1092012398 12:5125453-5125475 AGCAACATTTCATCATCAGATGG - Intergenic
1092018658 12:5181641-5181663 AGCAGCATTCCATCTCCTGAGGG - Intergenic
1092271801 12:7029818-7029840 AGCAGAACTCCATCATCAAATGG + Intronic
1092381576 12:8001087-8001109 AGTAGCATTCCATCATCAAATGG + Intergenic
1092656031 12:10686425-10686447 AGCACTACTCCATCATCAAATGG - Intergenic
1092922519 12:13245344-13245366 AGCAGCACTCCATCATCAAATGG - Intergenic
1093036354 12:14335832-14335854 AGCAGCATTCCATCATCAAATGG + Intergenic
1093048906 12:14484818-14484840 AGCAGCATTCCATCATCAAATGG - Intronic
1093049652 12:14490821-14490843 AGCAGCATTCCATAATCAAATGG - Intronic
1093645744 12:21583819-21583841 AGCAGCATTGCATCAGCAAATGG + Intronic
1093964554 12:25311105-25311127 AGCTGCATTCCATCATCAAATGG + Intergenic
1094102549 12:26779411-26779433 AGCAGCATTCTATCATCGAATGG + Intronic
1094389768 12:29936071-29936093 AGCAGCATTCCATCATCAAATGG - Intergenic
1095095394 12:38145217-38145239 AGCAGCACTCCAGCATGACACGG - Intergenic
1095121491 12:38424695-38424717 AGCAGCATTCCATCATCAATTGG - Intergenic
1095210323 12:39486315-39486337 AGCAGAATTCCTTCTTCACAGGG - Intergenic
1095603871 12:44044473-44044495 AACAGCATTCCACCATCAAATGG + Intronic
1096027376 12:48378589-48378611 AGCAACAATTTATCATCAAATGG + Intergenic
1096288730 12:50323109-50323131 AGCAGCATTCTGTCATCATATGG + Intergenic
1096457444 12:51799288-51799310 AGCAGCATTCCATCGTCAAATGG - Intronic
1096734807 12:53644349-53644371 AGCAGCATTGCATCATTAAATGG + Intronic
1097077016 12:56402590-56402612 AGAAGCATTCTGTCATCAAATGG + Intergenic
1097184801 12:57190831-57190853 AGCAGCATCCCAGCATCATGCGG + Exonic
1097437821 12:59572105-59572127 AGCAGCATTCCATCATCAAGTGG - Intergenic
1097554622 12:61121761-61121783 AGCAACATTCCATCATCAAATGG + Intergenic
1097564632 12:61252295-61252317 AGCAGCATTCCATTATCAAATGG - Intergenic
1097821324 12:64131715-64131737 AGCAGCATTCCATCATCAAATGG - Intronic
1097843340 12:64342612-64342634 AGCAGCATTCCATCATCAAATGG - Intronic
1098158384 12:67623753-67623775 AGCAACAATCCCTCGTCAAATGG + Intergenic
1098673053 12:73254393-73254415 AGCAACATTGCATCATCAAATGG + Intergenic
1098716108 12:73829961-73829983 AGCAGCATTTTGTCATCAGATGG + Intergenic
1098731069 12:74037497-74037519 AACAGTATTCCATCTTCAAAGGG + Intergenic
1098733309 12:74065780-74065802 AGCAACATTCCATCATCAAATGG + Intergenic
1098749860 12:74279739-74279761 AACAGCATTCCATCATTAAATGG + Intergenic
1098831890 12:75373876-75373898 AGAAGCATTTCATCATCAAATGG - Intronic
1099365943 12:81765533-81765555 AGCAGCATCCCGTCATCAAATGG + Intergenic
1099375665 12:81894106-81894128 AGCAACATTCCATCATCAAATGG + Intergenic
1099379364 12:81936392-81936414 CACAGGATTCCATCATCAAATGG - Intergenic
1099401187 12:82205209-82205231 AGCAGCATTTCATCATTAAACGG - Intergenic
1099508579 12:83507336-83507358 AGCAGCATTCCATCATCAAATGG + Intergenic
1099526380 12:83723257-83723279 AACAGCATTCTATCATCAAATGG + Intergenic
1099578092 12:84405540-84405562 AGCAGCATTCCATCATCTAATGG + Intergenic
1099864720 12:88265223-88265245 AGCAACAACCTATCATCAAATGG + Intergenic
1100083321 12:90878361-90878383 AGAAACATTTCATCATCAAATGG + Intergenic
1100231969 12:92618000-92618022 AGCAGCACTTCATCATCAAGTGG + Intergenic
1100241134 12:92711459-92711481 AGCAGCATTTCATCATCAAATGG - Intergenic
1100790175 12:98121656-98121678 AACAGAACTCCATCATCAACAGG - Intergenic
1101264149 12:103066271-103066293 AGCAGCATTTCATCATCAAATGG + Intergenic
1101309652 12:103564520-103564542 AGCAGCATACCAGCAACAGAGGG + Intergenic
1101534651 12:105605955-105605977 AGCAGCATTTCATCATCAAGTGG - Intergenic
1101543089 12:105682785-105682807 AGCAGCATTCCATTATCCAGTGG + Intergenic
1101572386 12:105965755-105965777 AGCAGCATTCCATTATCAAATGG - Intergenic
1101807239 12:108075083-108075105 ACCATCATACCATCATCATATGG + Intergenic
1102211208 12:111128540-111128562 AGCAGCATTCCATCATCAAATGG - Intronic
1102211845 12:111132873-111132895 AAAAGCATTCCATCTTAAAAGGG - Intronic
1103035629 12:117654223-117654245 AGCAGCATTTCATCATCAAATGG + Intronic
1103396544 12:120611596-120611618 AGCAGCATTCCATCATCAAATGG + Intergenic
1104317242 12:127714711-127714733 AGCAGCATTCCATGGTTGAAAGG + Intergenic
1105383993 13:19913373-19913395 AGCAGCATTCCATCATCAAATGG + Intergenic
1105740131 13:23315329-23315351 AACAGCATTCCATCATCAAATGG + Intronic
1105852756 13:24350168-24350190 AGCAACACTCTGTCATCAAATGG - Intergenic
1106545157 13:30724784-30724806 AGCAGTGTTCCATCATCAAATGG + Intronic
1107184048 13:37496236-37496258 AGTAGAATTCCATTGTCAAATGG - Intergenic
1107216480 13:37926206-37926228 AAGAGCATTCTATCATGAAAAGG + Intergenic
1107983557 13:45755823-45755845 AGCAGCATTCCGTCATCACATGG - Intergenic
1108047898 13:46400512-46400534 AGCTCCTTTCCATCCTCAAATGG + Intronic
1108302414 13:49091837-49091859 GGCAGCATTCCATCATCAAATGG - Intronic
1108335873 13:49441738-49441760 AGAAGCATACAATCATCAAAGGG + Intronic
1108914285 13:55588723-55588745 AGCGGCATTCTATCATCAAATGG - Intergenic
1108940450 13:55947035-55947057 AGCAAAAATCCTTCATCAAAAGG + Intergenic
1109293241 13:60500267-60500289 AGCAGCATTCCATTATCAAATGG + Intronic
1109392336 13:61709134-61709156 AGCAGCATTTAATCATCAAATGG + Intergenic
1109449975 13:62499596-62499618 AACAGCATTGCATGGTCAAAAGG - Intergenic
1109583066 13:64366315-64366337 AGCAGCATTCCATCATCAAATGG + Intergenic
1109712666 13:66180673-66180695 AGAAGCATTCCATCATCAAATGG - Intergenic
1109951010 13:69502056-69502078 AGCTGCATTCTGTCATCAAATGG - Intergenic
1109992041 13:70071270-70071292 AGCAGCACTACATGATAAAAGGG + Intronic
1110377185 13:74806618-74806640 AGCAGCATTCTATCATCAAATGG + Intergenic
1110386585 13:74919194-74919216 TAGAGCATTCCATCATCTAAGGG - Intergenic
1110834119 13:80064480-80064502 AGCAGCATTCCATCATCAAATGG - Intergenic
1111057783 13:82972878-82972900 AGTAGCATTCCATCATCATATGG - Intergenic
1111317515 13:86581950-86581972 AGCAGCATTCCGTCATCAAATGG + Intergenic
1111370801 13:87313983-87314005 AGCAGCACTCCATTACCAAATGG + Intergenic
1111470882 13:88680910-88680932 AGCAGCACTCCATCACGAAATGG - Intergenic
1111535224 13:89595321-89595343 AGCAGCATTCTATCATCAAATGG + Intergenic
1112231113 13:97590015-97590037 AGAAGCATTCCATCATTAAATGG - Intergenic
1112249912 13:97770129-97770151 AGTAGCATTCCATCATCAAATGG - Intergenic
1112720887 13:102243357-102243379 ATCAGGATTCCATATTCAAATGG - Intronic
1113111584 13:106829420-106829442 AGCAACATTATATCATCAGATGG - Intergenic
1113212071 13:107994833-107994855 AACAGCAATCCATCATCATGTGG + Intergenic
1113319689 13:109221514-109221536 AGCAGCTTCCCATCATCAAATGG - Intergenic
1113396155 13:109949681-109949703 AGCAGCATTCCATTATCAAATGG + Intergenic
1114205885 14:20570917-20570939 AGCAGCATTGCATCATCAAGTGG + Intergenic
1114894923 14:26975637-26975659 AGTAGCCTTCAATCATAAAAAGG - Intergenic
1114896327 14:26995152-26995174 AACAGAACTCTATCATCAAATGG - Intergenic
1115130711 14:30049409-30049431 AGCAGCATTCCATCATCAGATGG + Intronic
1115143416 14:30199523-30199545 AGCAGCATTCCATCATCAGATGG + Intergenic
1115310849 14:31976348-31976370 AGCAGCACTCCATCATCAGATGG - Intergenic
1116058926 14:39897087-39897109 AGCAGCATTCCATCATCAAATGG + Intergenic
1116158363 14:41236517-41236539 AGCAGCATTCCATCATCAAATGG - Intergenic
1116279248 14:42880805-42880827 AGTGGCATTCCATCACAAAATGG - Intergenic
1116308025 14:43283298-43283320 AGAAACATTCCATCATTAAATGG - Intergenic
1116415092 14:44669459-44669481 AGCAACATTCCGTCATCAAATGG + Intergenic
1116531439 14:45978079-45978101 AGCAGCATTCCATCATCAAATGG - Intergenic
1116917840 14:50542531-50542553 AGCAGAATTCCGTTGTCAAATGG + Intronic
1117001617 14:51376461-51376483 AGCAGCATTCCATCATCAAATGG + Intergenic
1117216860 14:53560324-53560346 AGCAGCATTCCATCATCAAATGG + Intergenic
1117596261 14:57329734-57329756 AGCAGCATTCCATCATCCAATGG - Intergenic
1117780094 14:59223241-59223263 AGCAGCACTCCATCATCAAATGG - Intronic
1118122421 14:62860021-62860043 AGCAGCATTCTATCATCAAATGG - Intronic
1118385484 14:65252396-65252418 AGCAGTACTCCATCATCAAATGG - Intergenic
1118501847 14:66369538-66369560 AGCAGCACTCTGTTATCAAACGG + Intergenic
1118880756 14:69823872-69823894 AGCAGCATCCCATCATCCAATGG - Intergenic
1119059682 14:71462041-71462063 AGCAGCATTCTATCATCAAATGG - Intronic
1119107547 14:71938692-71938714 AGCAGCATCCCATCATCAAATGG - Intronic
1120082006 14:80227381-80227403 AGCAGCATTGTATCATCAAATGG - Intronic
1120112096 14:80569497-80569519 ATCAGCATTCCATTATCCACAGG - Intronic
1120231411 14:81845102-81845124 AGTAGCATTCCATCAGCAAATGG - Intergenic
1120250729 14:82059527-82059549 AGCAGTACTCCATCACCAAATGG - Intergenic
1120555973 14:85930290-85930312 AGCAGCATTCCATCATCAAATGG - Intergenic
1120973718 14:90230975-90230997 AGCAGCATAACATCATCAAATGG + Intergenic
1122841450 14:104465916-104465938 AGCAACACTCTGTCATCAAATGG - Intergenic
1202935466 14_KI270725v1_random:83540-83562 AGCAGCATTGCATCATCAAATGG - Intergenic
1124571719 15:30870503-30870525 AGCAGAACTCCGTCATCAAATGG + Intergenic
1124703363 15:31936961-31936983 AGCAGCACTCCATCATCAAATGG + Intergenic
1124733938 15:32226432-32226454 AGTAACAATCTATCATCAAATGG - Intergenic
1124863394 15:33465310-33465332 AGCAGGATTGCTTCATCATATGG + Intronic
1125884075 15:43215303-43215325 AGCAGCCTTCCAAGATCAACAGG - Exonic
1126283624 15:46986426-46986448 ACCAGCATTTCATCATCAAATGG + Intergenic
1126777814 15:52114199-52114221 AGCAGCCACCTATCATCAAATGG + Intergenic
1127495383 15:59506416-59506438 AACAGCACTCCATCTTCAAGGGG - Intronic
1128561895 15:68674178-68674200 ACCAGCATTCCACCAGCAGAGGG - Intronic
1128642828 15:69352376-69352398 AGCAGCATTCCATCATCAAATGG + Intronic
1130689380 15:86067374-86067396 ATCAGCATTCCCTCCTTAAAAGG + Intergenic
1131724025 15:95202944-95202966 AGCAGAATTCCACCACCGAATGG + Intergenic
1135061622 16:19275857-19275879 AGCAGCACTCCTTCATCAAATGG - Intergenic
1135626024 16:23995644-23995666 AGCAGCACTTCATCATCAAATGG + Intronic
1136250956 16:29004740-29004762 AGCAGCATTGTATCATCAAATGG + Intergenic
1137091100 16:36191926-36191948 AGTAGAATGCAATCATCAAATGG - Intergenic
1137215784 16:46388558-46388580 AGTAGAATGCAATCATCAAATGG + Intergenic
1137216714 16:46400603-46400625 AGTAGAATGCAATCATCAAATGG + Intergenic
1137652746 16:50134510-50134532 AGGAGCACTCCACCATCAAATGG - Intergenic
1138318819 16:56093609-56093631 AGCAGCATTCCATCATCGAATGG - Intergenic
1140607961 16:76563745-76563767 AGCAGGAAGCCATCATCAACTGG - Intronic
1141559524 16:84857889-84857911 AGCAGCATTCCATCATCAAATGG - Intronic
1141793549 16:86252910-86252932 ATCAGCATCCCAGCATCAATGGG + Intergenic
1144127493 17:12216734-12216756 GGCTGCATTCCTTCATGAAAGGG - Intergenic
1145260826 17:21353434-21353456 AGCATCATGCAATCATCACAAGG + Intergenic
1146238002 17:31186098-31186120 AGCAGCATTCCATCATCAAGTGG + Intronic
1146634587 17:34494647-34494669 AGCAGCATTGCAGCCTCAATGGG + Intergenic
1146831365 17:36072144-36072166 AGCAGTATTCCTTCTTCAGAGGG - Intergenic
1146836374 17:36114149-36114171 AGCAGCATTCCATCATCAAATGG + Intergenic
1146850949 17:36221189-36221211 AGCAGCATTCCATCATCAAGTGG + Intronic
1149126930 17:53245877-53245899 AGTAGCACTTCATCATCAGAGGG - Intergenic
1150975750 17:70084680-70084702 AGCATAATTCCATGAGCAAAAGG - Intronic
1151037794 17:70821449-70821471 AGCAGCATTCCATCATCAAATGG - Intergenic
1151518001 17:74609138-74609160 AGAACCAATCCATCATCACAAGG - Intergenic
1153089726 18:1330306-1330328 AGCAGCATTCCATCATCAAATGG + Intergenic
1153131257 18:1857562-1857584 AGCAGCATTCCATTATCAAATGG - Intergenic
1153217679 18:2835458-2835480 AGCAGCATTCCATCATCAAATGG - Intergenic
1154068478 18:11131243-11131265 AGCAGCATTCCATCATCAAATGG + Intronic
1154129518 18:11724704-11724726 AGCAGCACTCCATCATCAAATGG - Intronic
1154252656 18:12757130-12757152 AGCAGCATTCCATCATCAAATGG - Intergenic
1155234286 18:23803976-23803998 AGCAGCATTCCGTCATCAAATGG - Intronic
1155940773 18:31800062-31800084 AGCAGCATTCCATCATCAAATGG + Intergenic
1156211144 18:34944350-34944372 AGCAGCATTCCTTCATCTCTGGG + Intergenic
1156303877 18:35858839-35858861 TGCAGCATTCCATCATCAAATGG + Intergenic
1156582569 18:38394609-38394631 AGCAACATTTCATCATCAAATGG + Intergenic
1156606388 18:38671909-38671931 AGCAGTATTCCATCATTAAATGG + Intergenic
1156990287 18:43400630-43400652 AGCAGCATTCCATCATCAAATGG - Intergenic
1156998594 18:43497874-43497896 AGCAACACCCCATCATCAAATGG + Intergenic
1157149639 18:45203617-45203639 AGTAGGATCCCATCTTCAAAAGG - Intergenic
1157341219 18:46780172-46780194 AGCAGCATTCCATCATCAAATGG + Intergenic
1157870914 18:51229436-51229458 AGCAGTATTTCATCATCAAATGG - Intergenic
1158065558 18:53403045-53403067 AGAAGAATTCCATGGTCAAAAGG - Intronic
1159151883 18:64532590-64532612 AACAGCATTCCATCATCAAATGG - Intergenic
1159168852 18:64736665-64736687 AGAAGCACTCTATCATCAAATGG + Intergenic
1159287802 18:66375626-66375648 AGCAGCATTCCATCAACAAATGG + Intergenic
1159363301 18:67432998-67433020 ATCAGCATTCCATCCACATATGG + Intergenic
1159559086 18:69975219-69975241 AGCAGCATTCCATCAACAAATGG - Intergenic
1159711313 18:71764268-71764290 AGCAGCATTTCATGGTCAAATGG + Intronic
1160092477 18:75840156-75840178 AGCAGCATTCCATCATCAAATGG + Intergenic
1162208856 19:9075959-9075981 AGCCGCATGCCCTCATCATAGGG + Intergenic
1164097070 19:22021198-22021220 AACAGCATTCCATCATCAAATGG - Intergenic
1164117244 19:22234429-22234451 AACAGCATTCCATCATCAAATGG - Intergenic
1164904318 19:31954576-31954598 AGGAGCTTTCCATCATGAACTGG + Intergenic
1167951598 19:53032071-53032093 AGCAGCATTCCATCATCAAATGG + Intergenic
925279968 2:2677013-2677035 AGCAGCATTCCATCATCAAATGG + Intergenic
925460743 2:4060591-4060613 AGCAGCATTCCATCATCAAATGG + Intergenic
925499393 2:4486779-4486801 AGCAGCATTCCATCATCTAATGG - Intergenic
926142019 2:10373350-10373372 AGCAGCATGCCATCATGAACTGG - Intronic
926810376 2:16750531-16750553 AGCAGCATTCCATCATCAAATGG - Intergenic
926826778 2:16913813-16913835 AACAGCATTCCATCATCAAATGG + Intergenic
927316052 2:21684424-21684446 AGCAGCATTCGTTCATCAAATGG - Intergenic
927660448 2:24988814-24988836 AGCAGCATTCCATCATCAAATGG + Intergenic
927816418 2:26221524-26221546 GGTAGCACTCCATTATCAAATGG + Intronic
928486753 2:31739923-31739945 AGCAGCCTTCCACCATCAAGTGG - Intergenic
928699928 2:33888245-33888267 AACAGGATTGAATCATCAAAGGG + Intergenic
928944779 2:36762466-36762488 ACCAGCATTCCAACATAAAAGGG + Intronic
929269807 2:39960640-39960662 AGCAATATTCCATCATCAAGTGG - Intergenic
930295391 2:49547364-49547386 AGCAGCATTCCATCATCAAATGG - Intergenic
930418620 2:51121140-51121162 AGCAGCACTCCATCATCAAATGG + Intergenic
930910166 2:56621044-56621066 AGCAGCATTCCATCATCAAATGG + Intergenic
932870690 2:75394936-75394958 AGCAGCATTCCATCGTGAAAAGG - Intergenic
933394452 2:81713210-81713232 AGCAGTGTTCCAGCATCAAATGG - Intergenic
933504757 2:83162613-83162635 AGAAGCATTCCATCATCAAATGG - Intergenic
933892283 2:86782931-86782953 AGCAGCATTTCTCCACCAAAGGG - Intergenic
934305754 2:91820740-91820762 AGCAGCATTCCATCATCAAATGG + Intergenic
934327502 2:92032002-92032024 AGCAGCATTCCATCATCAAATGG - Intergenic
934465889 2:94262581-94262603 AGCAGCATTCCATCATCAAATGG - Intergenic
934534766 2:95123700-95123722 AGCAACACTCCATCATCGAATGG - Intronic
935183951 2:100715046-100715068 AGCAGCATTCCATCATCAAATGG + Intergenic
935389599 2:102536465-102536487 AGCAGCATCACAGCATCAAGGGG - Intergenic
935425090 2:102911180-102911202 AGCAGCACTCCATCATCCAATGG - Intergenic
935441450 2:103102410-103102432 AGAACAATTCCATCATCACAAGG - Intergenic
935564297 2:104590106-104590128 AGCAGCATTCCATCACCAAATGG - Intergenic
936084974 2:109461163-109461185 AGCAGCATTCCATGACCAAATGG - Intronic
936430569 2:112458911-112458933 AATAGCATTCCATCCTCACAGGG - Intergenic
936573022 2:113632195-113632217 AGGAGCATTTCAACAACAAAAGG + Intronic
936641241 2:114314834-114314856 AGCAGCATTCTACTATCAAATGG + Intergenic
936646272 2:114376235-114376257 AGCAGCATTCCATCATCAAATGG - Intergenic
936774289 2:115954417-115954439 AGCAGCACTCTATCTTCAAATGG + Intergenic
937531209 2:122829752-122829774 AACTGCACTCCATCATCAAATGG + Intergenic
937582048 2:123499020-123499042 AGCAGCATTCCATCATGAAATGG - Intergenic
937777725 2:125799730-125799752 AGCAGCATTTCATTTTTAAAAGG + Intergenic
937785187 2:125887581-125887603 AGCAGCATTCCATCATCAAATGG - Intergenic
937800342 2:126074875-126074897 AGCGGCATTTCATCATCAAATGG + Intergenic
937852551 2:126648591-126648613 AGCAACATTCCATCATCAATTGG - Intergenic
937867168 2:126761208-126761230 AGCAGGATTCCATCATCAACTGG + Intergenic
938375555 2:130803519-130803541 AGCAACACTCCATTATCAAGTGG + Intergenic
939069080 2:137518003-137518025 AGCAGCATTAAATCATCAAATGG + Intronic
939213888 2:139212387-139212409 ATCAGCACTCCATCATCAAATGG + Intergenic
939742889 2:145931984-145932006 AGCAGCATGCCATGCACAAAAGG - Intergenic
939755297 2:146102305-146102327 AGCAGCATAGCATCATCACATGG + Intergenic
939788669 2:146545966-146545988 AGCAGCATTCCATCATCAAATGG - Intergenic
939806254 2:146778621-146778643 AGCAGCATTCAATCATCAAATGG + Intergenic
939967926 2:148628800-148628822 AGCAGGATTCCTGGATCAAATGG + Intergenic
940171298 2:150832565-150832587 AGCAGCATTTCATCATCAAATGG - Intergenic
940605899 2:155924141-155924163 AGCAGCATTCTGTCATCAAATGG - Intergenic
941330651 2:164174418-164174440 AGCAGCATTCCATCATCAAATGG - Intergenic
941668036 2:168261275-168261297 AGCAGCATTCCATCATCAAATGG + Intergenic
942987929 2:182164141-182164163 AGCAGTATTCTATCGTCACATGG + Intronic
943006911 2:182395988-182396010 AGCAGCATTCAGTCATCAAATGG + Intronic
943190239 2:184667569-184667591 AGCAGGATTACATAATGAAAAGG + Intronic
943239201 2:185362425-185362447 AGCAGTATTCCATCATCGAATGG - Intergenic
943263594 2:185697369-185697391 AGCAACATTCCACCATCAAATGG + Intergenic
943384048 2:187180943-187180965 AGCAGCATTCCATCATCAAATGG - Intergenic
943517579 2:188907097-188907119 AGAGGCAGTCCATCATCAAATGG - Intergenic
943799903 2:192044925-192044947 AGCAGCACTCCATCATCAAATGG + Intronic
944572337 2:201057195-201057217 GGCAGCATTCCATGATGAAATGG + Intronic
945544882 2:211138290-211138312 AGCAGCATTCCATCATCAAATGG + Intergenic
945642195 2:212443984-212444006 ATCAGCATTCCATCACCAAACGG + Intronic
945725828 2:213471348-213471370 AGCAGCATTCCATCATCAAATGG - Intronic
946265517 2:218538007-218538029 AACAGCAATTCATCATAAAATGG + Intronic
946703755 2:222437645-222437667 AGCAGCATTCCATCATCAAATGG - Intronic
946718379 2:222577536-222577558 AGCAACATTCCATCAACACAGGG + Intronic
946790942 2:223299907-223299929 AGCAGCATTCCATCATCAAATGG + Intergenic
946873520 2:224106290-224106312 AGCAATACCCCATCATCAAATGG - Intergenic
946988030 2:225295960-225295982 ATCAACAATTCATCATCAAATGG - Intergenic
947083234 2:226421802-226421824 AGCAGCAGGGCATCATCATATGG - Intergenic
947440863 2:230120401-230120423 AGCAGCATTTCATCATCAAATGG + Intergenic
947653705 2:231808586-231808608 AGGAGAATGCCATCATCAGAGGG - Exonic
1170869472 20:20191885-20191907 AGCAGCATTTTAAAATCAAAAGG - Intronic
1171330049 20:24329492-24329514 AGCAGTACTCCATCACCAATTGG - Intergenic
1171448474 20:25220731-25220753 AGCAGCCTGCCATCCTCGAAAGG + Intronic
1173703663 20:45094727-45094749 AGCTGCATTCCTTCCTCCAAAGG - Exonic
1175499625 20:59440684-59440706 AGCAGTGGTCCATCATAAAACGG + Intergenic
1176596888 21:8705776-8705798 AGCAGCATTGCATCATCAAATGG - Intergenic
1176998177 21:15580331-15580353 AGCAGCATTCCATCATCAAATGG + Intergenic
1177139399 21:17342122-17342144 AGCAGCATTCCATCATCAAATGG - Intergenic
1177913193 21:27056357-27056379 AGTAGCATCCCATCATCAAATGG + Intergenic
1177933680 21:27316785-27316807 AACAGCATTCCATCATCAAATGG - Intergenic
1178060736 21:28850992-28851014 AGCATCATTCCGTTATCAGATGG - Intergenic
1178310311 21:31524716-31524738 AGGAGCATTGCATGATAAAATGG - Intronic
1179055490 21:37928190-37928212 AGCAGCGTTCCATTATAAAATGG - Intergenic
1179258442 21:39737832-39737854 TGCAGCATTCCTTCCTCCAAGGG + Intergenic
1179415135 21:41192391-41192413 AGCAGCATTCCATCATCAAATGG - Intronic
1179458172 21:41513997-41514019 AGCAGCACTCCATCGTCAAATGG - Intronic
1180279810 22:10683218-10683240 AGCAGCATTGCATCATCAAATGG - Intergenic
1180587026 22:16901754-16901776 AGCAGCATTCCATCATCACATGG - Intergenic
1180591129 22:16938220-16938242 AGCAGTATTCCGTCATCAAATGG - Intergenic
1181367420 22:22388797-22388819 AGCAGCATTCCATCATTCAGTGG - Intergenic
1181420669 22:22795977-22795999 AGCAGCATTCCATCATCAAATGG + Intronic
1184603544 22:45558228-45558250 AGCAGCATTCCATCATCAAATGG - Intronic
1184638670 22:45856890-45856912 AGCAGCGCTCCATCATCAACTGG - Intergenic
1185427166 22:50778679-50778701 AGGAGCATTTCAACAACAAAAGG - Intronic
949117406 3:343934-343956 AGAAGACTTCCATCTTCAAAGGG - Intronic
949125646 3:442999-443021 ATCAGTATTCCATCATCAAATGG - Intergenic
949170023 3:986457-986479 AGCAGCACTGGATCATCAAACGG - Intergenic
949245882 3:1925069-1925091 AGCAGCATTCCATCATCAAATGG + Intergenic
949345136 3:3069433-3069455 AGCATAATTCAATCATGAAAGGG - Intronic
949417574 3:3830740-3830762 AGCAGCATTCCATCATCAAATGG - Intronic
949445624 3:4131200-4131222 AGTAACTTTCCATCATCAAATGG + Intronic
949638794 3:6012663-6012685 AGCAGCATTCCATCATGAAATGG + Intergenic
949749203 3:7331378-7331400 AGCAGAATTAAATGATCAAAAGG + Intronic
949751330 3:7355709-7355731 AGCAGGACTCCATCATCAAATGG + Intronic
949905893 3:8858203-8858225 AGCAAGACTCCATCATCAAATGG + Intronic
950089674 3:10286781-10286803 AGCTTGATTCCAACATCAAAGGG + Exonic
950963814 3:17132133-17132155 AGGAGCAATGCTTCATCAAAGGG - Intergenic
951571085 3:24064044-24064066 AGCAGCACTCCATCATCAAATGG - Intergenic
951970744 3:28441719-28441741 AGCAGCATTCCATAATCAAATGG - Intronic
952363637 3:32655043-32655065 TGCAGCAATCCATCATCAGGCGG + Intergenic
952560344 3:34585239-34585261 AGCAGCACACCTTTATCAAAAGG - Intergenic
952587694 3:34912485-34912507 AGCAGCACTCCCTTACCAAATGG - Intergenic
952605423 3:35141869-35141891 AGCAGCATTCCATCATCAAATGG - Intergenic
953727486 3:45412929-45412951 AGGAGCAGTCCATCAGCAGAAGG - Intronic
953740620 3:45535663-45535685 AGAAGAGTTCCATCATCACAAGG - Intronic
953804796 3:46059060-46059082 AATAGCACTCCATCATCAAATGG + Intergenic
954054174 3:48008111-48008133 AGCAGCATTCCATCATCAAATGG + Intronic
954511471 3:51129518-51129540 AGCAGCATTACATCATCAAATGG - Intronic
954597732 3:51841192-51841214 AGCATCAATCCATCATAAGATGG + Intergenic
956306895 3:67835772-67835794 AGCAGCATTGTATCATCAGATGG + Intergenic
956509674 3:69980518-69980540 AGCAGCATTCCATCATCAAATGG + Intergenic
957239066 3:77635006-77635028 ACCAGCATTGCCTCATCGAAGGG + Exonic
957247563 3:77733751-77733773 AGTGGCATTCCATCATTAAATGG - Intergenic
957298480 3:78361497-78361519 AGCAGCATTTCATCATTAAATGG - Intergenic
957480514 3:80787582-80787604 AGCAACACTCCATCATTAAATGG + Intergenic
957744286 3:84318382-84318404 AGCAACACTGCATCACCAAATGG - Intergenic
957754612 3:84469572-84469594 AGCAGCATTCCATCATCAAATGG + Intergenic
957770118 3:84679695-84679717 AGAAACATACCATCATCAGAAGG - Intergenic
957969711 3:87367004-87367026 GGCAGCACTCCTTCATCAAATGG - Intergenic
958485024 3:94694320-94694342 AACAGCAATCCATCATAAGATGG - Intergenic
958487661 3:94732328-94732350 ACCAGCATTCCATCATCAAATGG - Intergenic
958667666 3:97161090-97161112 AACAACACTCCATCATCAAATGG - Intronic
958845672 3:99261613-99261635 AGCAGCATTCCATCATCAAATGG - Intergenic
958934320 3:100240773-100240795 AGCAGCATTCCATCATCAAATGG + Intergenic
958942393 3:100330910-100330932 ATCAGCATTCCTTCCTCCAAGGG - Intergenic
959100147 3:102000959-102000981 AGCAGTACTCCATCATCAAATGG - Intergenic
959226765 3:103597130-103597152 AGCAGCATTCCATCATCAGATGG - Intergenic
959439530 3:106359328-106359350 AGCAGTATTCCATCATCAGATGG + Intergenic
959790363 3:110353789-110353811 ACCATCATTCTATCATGAAAGGG - Intergenic
960176865 3:114527522-114527544 AGCTGTATTCCATTATCTAATGG + Intronic
960349545 3:116575847-116575869 AGCAGCATTCCATCATCAAATGG + Intronic
960494730 3:118360634-118360656 AGCAGCATTCCATCATCAAATGG - Intergenic
961621332 3:128227252-128227274 AGCAGAATTCCTTCATGAAAAGG - Intronic
962303082 3:134260707-134260729 AACAGCATTCCAGCAGCCAAGGG + Intergenic
963268098 3:143259100-143259122 AGCAGTACTCCATAATTAAATGG - Intergenic
963331799 3:143923227-143923249 AGCAGCATTCCATCATCAAGTGG - Intergenic
963355645 3:144206715-144206737 AGCAGCATTCCATCATCAAATGG - Intergenic
963630321 3:147723353-147723375 AGCACCATTCCATCATCAAATGG + Intergenic
963661409 3:148132291-148132313 AGCAGCATTCCATCATCAAATGG + Intergenic
964679227 3:159318768-159318790 AGCAGCATTCCATAATCAGATGG - Intronic
965076730 3:163988842-163988864 ATAAGAATTTCATCATCAAAAGG + Intergenic
965226747 3:166000614-166000636 AGTAGCATTCCATCATCAAATGG - Intergenic
965511999 3:169578514-169578536 AGCAGCATTTCATCATCCACTGG - Intronic
966044311 3:175530775-175530797 AGTAGAATTCCATCATCAAATGG - Intronic
966661328 3:182418155-182418177 AGCAACACTCTATCGTCAAATGG + Intergenic
966896712 3:184450421-184450443 AGCAATACTCCATCATGAAACGG - Intronic
967070020 3:185954317-185954339 AGCAGACTTCTTTCATCAAAGGG + Intergenic
967512042 3:190323226-190323248 AGCAGCAATTCATTATCAGAGGG + Intronic
967831795 3:193926136-193926158 AGCAGCATTCCATCAGCCAATGG + Intergenic
969108400 4:4825673-4825695 AGCAGCATTGCAGCATCACCTGG - Intergenic
970524007 4:16913215-16913237 AGCAACACTCCATTATCCAATGG + Intergenic
971100996 4:23466276-23466298 AGAAGCATTCAATCATCAAATGG - Intergenic
971899324 4:32638255-32638277 AGCACCATTCTTTAATCAAAAGG + Intergenic
972085239 4:35207248-35207270 AGCAGCATTCCATTATCAAATGG + Intergenic
972095512 4:35342835-35342857 AGCAGCATTCTATTATGAAATGG + Intergenic
972882945 4:43448008-43448030 AGCAGCATTACATCATCAACTGG - Intergenic
973036739 4:45416557-45416579 AGCAATACTCCATCATCAAATGG + Intergenic
973102942 4:46294894-46294916 AGCAGCACTCGATCATCAAATGG + Intronic
973118460 4:46489197-46489219 AGCAGCATTCCATCATCAAATGG + Intergenic
973120970 4:46520752-46520774 AGCAGCATTCCTTTATCAAATGG - Intergenic
973130174 4:46639552-46639574 AGCAGTATTCCATCATTAAATGG - Intergenic
973798869 4:54456671-54456693 AACAGCTTTTTATCATCAAATGG + Intergenic
973975243 4:56256616-56256638 AGCAGTACTCCATCATCAAATGG + Intronic
974243568 4:59283879-59283901 AACAATATTCCATTATCAAATGG - Intergenic
974262354 4:59542123-59542145 AGCAGCATTCCATCATCAAATGG - Intergenic
974289585 4:59912888-59912910 AGCAGCATTCCATCATTAAATGG + Intergenic
974319294 4:60324172-60324194 AGCACATTTCCATAATCAAAAGG - Intergenic
974479025 4:62420690-62420712 AGCATCATTCCATCATCAAATGG - Intergenic
974644598 4:64674619-64674641 AGCAGCATTCCATCATCAAATGG - Intergenic
974688543 4:65265736-65265758 AGAAGTATGACATCATCAAATGG + Intergenic
974727230 4:65812668-65812690 CTCAGCATTCCGTCATCAAATGG + Intergenic
974746902 4:66088759-66088781 AGCAGCATTCTATCTTCAAATGG - Intergenic
975024479 4:69531778-69531800 AGCAGTGCTCTATCATCAAATGG + Intergenic
975386702 4:73767363-73767385 AGCAGCATTCCATCATTAAATGG - Intergenic
975427061 4:74242015-74242037 AGAACATTTCCATCATCAAAAGG - Intronic
977031635 4:91891553-91891575 AGCAGCATTCCATCATCAAATGG + Intergenic
977204725 4:94155783-94155805 AGCAGCATTCCGTCATCAAATGG + Intergenic
977466016 4:97383520-97383542 AGCAGCATTTCATCATCAAATGG + Intronic
977626256 4:99192508-99192530 AGGAGCATCCCATCATCAAATGG - Intergenic
977701718 4:100029741-100029763 AGCAGCATTACATTATTAAATGG - Intergenic
977753105 4:100633151-100633173 GGAAGCACTCCATCATCAAATGG - Intronic
977833258 4:101618022-101618044 AGCAGCATTCCATTATCAAATGG - Intronic
977847081 4:101779075-101779097 AGCAGCACTACATCATCAAGTGG - Intronic
977898719 4:102394734-102394756 AGCAGCATTCCATCATCAAATGG + Intronic
977930394 4:102743673-102743695 AGCAGCATTCCCTCATCAAATGG - Intronic
978341576 4:107725403-107725425 AGCAGCATTCCATCAGCAAATGG - Intergenic
978772135 4:112467634-112467656 AGCAGCATTCCATCATCAAATGG - Intergenic
978966869 4:114751088-114751110 AGCAGCAATCCATCATCAAATGG + Intergenic
979065980 4:116133268-116133290 GGCAGCATTCCATTTTAAAAGGG - Intergenic
979203068 4:118002519-118002541 TGCAGCATCCCAACAACAAAGGG + Intergenic
979767037 4:124474741-124474763 AGCAGCATTCCATCATCAAATGG + Intergenic
979898384 4:126188911-126188933 AGCAGCATTCCATCATCAAATGG - Intergenic
980385772 4:132086885-132086907 AACAGCATTCCATCATTAAATGG - Intergenic
980387929 4:132111035-132111057 AGCAGCATTTCATCATCAAATGG - Intergenic
980405873 4:132353645-132353667 AGCAGCATCCCGTCATCAAATGG - Intergenic
980602220 4:135040166-135040188 AGCAGAATTCCATCACCAAATGG + Intergenic
980629540 4:135414432-135414454 AGCCCCATACCATCATCAAATGG + Intergenic
980822973 4:138040146-138040168 ACCAGCACTCCATCATCAGATGG - Intergenic
980957748 4:139446063-139446085 AGCAGCATTCCATCATCAAATGG + Intergenic
981160929 4:141497704-141497726 AGCAGCACTCTCTCATCCAATGG + Intergenic
981462825 4:145031944-145031966 AGCAGCATTCCATTATCAAATGG + Intronic
981832962 4:149023158-149023180 AGCAACATCCCCTCATCAAATGG + Intergenic
981873558 4:149515344-149515366 AGCAGCATTCCATCATCAAATGG + Intergenic
982597760 4:157406885-157406907 AACAGCATTCCATAACCAAATGG - Intergenic
982623323 4:157732755-157732777 AGCAGCATTCCAACATCAAATGG - Intergenic
982673033 4:158345382-158345404 GGCAGCCCTGCATCATCAAATGG + Intronic
982788293 4:159560982-159561004 AGCAGCAATGCATTATCAAATGG - Intergenic
982835560 4:160116787-160116809 AGTAGCATTCCATCATCAAATGG + Intergenic
982847788 4:160274445-160274467 AGCAGGATTCCATTGTCAAATGG + Intergenic
983126711 4:163961609-163961631 AGCAGCATTATATGATCAAAGGG + Intronic
983185080 4:164691720-164691742 AGCAGCATTCCATCATCAAATGG + Intergenic
983582695 4:169324958-169324980 AGCAGCATTTCATCATCAAATGG + Intergenic
986025591 5:3847560-3847582 AGCAGCATTCTATTATCAAATGG + Intergenic
986087126 5:4462864-4462886 AGCAGCATTCCATCATCAAATGG + Intergenic
986531390 5:8740181-8740203 AGTAGCATTCTGTCATCAAATGG - Intergenic
986742938 5:10719652-10719674 AGCAGCATTCCATCATCGAATGG + Intronic
986743019 5:10720270-10720292 AGCAGCATTCCATCATCAAATGG - Intronic
986938316 5:12918604-12918626 AGCAGCATTCCATCATCAAATGG - Intergenic
987153192 5:15061812-15061834 AGCAGCTTTCCAACATCAAATGG + Intergenic
987466250 5:18275430-18275452 AACAGCATTCCATCATCAAATGG - Intergenic
987468173 5:18296837-18296859 AGCAGCATTCCATCAACAAATGG - Intergenic
987885462 5:23806646-23806668 AGCAGCATTCCATCATCAAATGG + Intergenic
988079809 5:26401274-26401296 AGGGGCATTCCATCATCAAATGG - Intergenic
988107773 5:26772693-26772715 AGCAGCATTACATCATCAAATGG + Intergenic
988145937 5:27308339-27308361 TGCAGCATTCCATTATCAAATGG + Intergenic
988233272 5:28506943-28506965 AGCAGCATTCCATCATCAAATGG - Intergenic
988258188 5:28848687-28848709 ATCAGCACTCCATCATCAAATGG + Intergenic
988562148 5:32290990-32291012 AGCAACATTCCATCATCAAATGG + Intronic
989097843 5:37797466-37797488 AGCAGCATTCCATCATCAAATGG + Intergenic
989307486 5:39974476-39974498 AGCAGCATTGCATCATCAAATGG - Intergenic
989340126 5:40364729-40364751 AGCAGCACTCCATTATCAAATGG + Intergenic
989457625 5:41661621-41661643 AGAAGCATTCTATCATCAAATGG - Intergenic
989486367 5:41996212-41996234 AGCAGCATTCCATCATCAAATGG - Intergenic
989550318 5:42727253-42727275 AGCAACAATCCATCAACACATGG - Intergenic
989676935 5:43983350-43983372 AGCAACAGTCCATCATCAAATGG - Intergenic
990335571 5:54769136-54769158 AGCAGTAATCCATCATAAAATGG + Intergenic
991013786 5:61910742-61910764 AGCAGCATTCCATCATCAAATGG - Intergenic
991033559 5:62106069-62106091 AGCAGCATTCTATCACCAAATGG + Intergenic
991333401 5:65518471-65518493 AGAAGCTTTCCATCAGTAAAAGG - Exonic
993203410 5:84847687-84847709 AGCAGCATCTCATCATCAAATGG + Intergenic
993231885 5:85247385-85247407 AGCAGCATTCCATCATCAAATGG - Intergenic
993319836 5:86458724-86458746 AGCAGCATTCTGTCATCAAAGGG + Intergenic
993412564 5:87591665-87591687 CGCAGCATTCCATCATCAAATGG - Intergenic
993780709 5:92062539-92062561 AGCAGCATTCCATCATCCAATGG + Intergenic
993787733 5:92164696-92164718 GGCAGCACTCCATCATCAAATGG - Intergenic
994291355 5:98031824-98031846 AGCAACATTCCATGATCACATGG - Intergenic
994765422 5:103909879-103909901 AGTACCATTCCATTATCTAACGG + Intergenic
994855419 5:105113437-105113459 AGCAGCATTCTGTCATTAAATGG - Intergenic
994928321 5:106147912-106147934 AACAGCATTCCATCGAAAAATGG - Intergenic
994984400 5:106915582-106915604 AGCAGCATTCCATCATCAAATGG - Intergenic
995245414 5:109929834-109929856 AGCAGCATTTCATCTCTAAAAGG + Intergenic
995269537 5:110205318-110205340 AGCAGCATTTCATAATTAAATGG - Intergenic
995427718 5:112043579-112043601 AGCAGCATTTCATCATAAAATGG - Intergenic
995621354 5:114029650-114029672 AGCAACATTCCATTATAAAATGG + Intergenic
995776270 5:115727552-115727574 GGCAGCATTCCATCGTCAAATGG - Intergenic
996018575 5:118568003-118568025 AGCAGCATTCCATTATCAAATGG + Intergenic
996164942 5:120212361-120212383 AGCAGCATTCCATCATCAAATGG - Intergenic
996324576 5:122258505-122258527 AGCAGCATTCCAGCAATAGAGGG - Intergenic
996381696 5:122868264-122868286 AGCAGCACTCCATCATCAAATGG - Intronic
996392188 5:122973638-122973660 AGCAGCTTTTCACCATTAAATGG - Intronic
996825580 5:127677986-127678008 AGCAGTATTCCATCCTCAAATGG + Intergenic
996912249 5:128669126-128669148 AAAAGCATTTCATCATCAAACGG + Intronic
997179421 5:131813030-131813052 GGCAGCACTCCATTATCAAATGG + Intronic
997213223 5:132090065-132090087 AACAGCAATCCATCATAAGATGG - Intergenic
998290318 5:140908404-140908426 AGCAGCATTCCATCATCAAATGG - Intronic
998654879 5:144167189-144167211 ACCATCATTCCATCTTCAAGAGG + Intronic
999351403 5:150874992-150875014 AGCAGCATTCCATCATCAAATGG + Intronic
999486943 5:152006292-152006314 TGGAGCATTCCATCATAGAATGG - Intergenic
1000354596 5:160381849-160381871 AGCAGCAATCTATCCTCAAGTGG + Intergenic
1000883978 5:166729840-166729862 AGCAGCATGCCAGCAGCAAATGG - Intergenic
1001173614 5:169444791-169444813 AGCAGCATTCCATCATCAAATGG + Intergenic
1003758625 6:9150229-9150251 ACCAGCATTCCATCATCAAATGG + Intergenic
1003791243 6:9550192-9550214 AGCAGCATTCCATCATCAAAGGG + Intergenic
1004189271 6:13449996-13450018 AGCAGCATTCCTTAATTGAATGG - Intronic
1004824274 6:19403088-19403110 AGCAGCATTCCATCATCAAATGG - Intergenic
1005185187 6:23157220-23157242 AGCAGCATTCCATCATCAAATGG + Intergenic
1005578178 6:27209451-27209473 AGCAGCGTTCCATTATCAAATGG + Intergenic
1005921651 6:30407178-30407200 AAAAGCATTCCATTTTCAAAGGG + Intergenic
1006062365 6:31433370-31433392 AGCAGCATTCCATCATCAAATGG + Intergenic
1008266906 6:49439141-49439163 AGCAGCATTCCATCATCAAATGG - Intronic
1008400304 6:51055612-51055634 AGCAGCATTCCATCATCAAATGG + Intergenic
1008820417 6:55625297-55625319 AGCAGCATTCCATCATCGAATGG + Intergenic
1009390096 6:63134930-63134952 AGCAGCATTCCATCATTAAATGG - Intergenic
1009421228 6:63467072-63467094 TGCAGCACTCCACCATTAAAGGG + Intergenic
1009563218 6:65275387-65275409 AGCAGCACTTCATCATCAAATGG + Intronic
1009770318 6:68136705-68136727 AGCAGCATTCAACAATCAAATGG - Intergenic
1009806511 6:68607092-68607114 AGCAGCGTTCCATCATCAAATGG + Intergenic
1009851909 6:69208810-69208832 AGCACCATTCCATCATCAAATGG - Intronic
1010107987 6:72190764-72190786 AGCAGCATTCCATCATCAAATGG - Intronic
1010325310 6:74556451-74556473 AGCAGCATTCCATCATCAAATGG - Intergenic
1010406966 6:75516691-75516713 GGCAGCACTCCATCATAAAATGG - Intergenic
1010516702 6:76781975-76781997 AGTGGCATTCCATTATCAAATGG + Intergenic
1010580742 6:77593765-77593787 AGTAGCAATCCATCATCAAATGG - Intergenic
1010854090 6:80815280-80815302 AGCAACACTCCATCATCAAATGG - Intergenic
1010938229 6:81886264-81886286 AGCAGCCTTCCATCATGAAATGG - Intergenic
1011039330 6:83013127-83013149 AGCAGCATTCTGTCATCAAATGG - Intronic
1011069121 6:83361813-83361835 AGCAGCATTCCATCATCAAATGG + Intronic
1011136576 6:84106792-84106814 AGCAGCACTCCATCATCAAATGG - Intergenic
1011300655 6:85869350-85869372 AGCAGACTTCCATCACCTAACGG + Intergenic
1012001976 6:93665070-93665092 TGCAGCATTTCATCATCAAATGG + Intergenic
1012226107 6:96704970-96704992 AGCAACACCCCATCATCAAATGG + Intergenic
1012233847 6:96790175-96790197 AGCAAGATTCTATTATCAAAAGG + Intergenic
1012344603 6:98170467-98170489 AGCATCATTCCATCATCAAATGG + Intergenic
1012730480 6:102874465-102874487 AGCAGAATACCATCATCAAATGG + Intergenic
1012820823 6:104083066-104083088 GGCAGTATTTTATCATCAAATGG + Intergenic
1012920780 6:105219397-105219419 CGCGCCATTTCATCATCAAATGG - Intergenic
1013038346 6:106408690-106408712 AGCAGCCTTGCATCATCCCAGGG - Intergenic
1013406687 6:109849950-109849972 AGCAGCATTCTATCATCAAATGG + Intergenic
1013967207 6:115969363-115969385 AGCAGTATTGCTTCATCCAAGGG + Intronic
1014363380 6:120508207-120508229 AGCAGCATTCCATCATCAAATGG - Intergenic
1014417003 6:121195533-121195555 AGCAGCATTCCATCATCAAGTGG + Intronic
1014534177 6:122596458-122596480 AGCAGCATTCCATCATCAAATGG - Intronic
1014631659 6:123796949-123796971 AGCAGCATTCCATCATCAAATGG + Intergenic
1015466830 6:133557568-133557590 AGCGGTATTCCTTCATCAAATGG - Intergenic
1015475764 6:133657631-133657653 TCATGCATTCCATCATCAAATGG + Intergenic
1016119900 6:140332546-140332568 AGCAATATCCCATCATCAAATGG - Intergenic
1016144307 6:140649550-140649572 AGCAGCATCCCATCATCAAATGG + Intergenic
1016147313 6:140692568-140692590 AGCAGCATTCCATCATCAAATGG - Intergenic
1017044052 6:150330706-150330728 AGCAGCACTCCATCATCAAATGG - Intergenic
1017227793 6:152040944-152040966 AGCAGCATTCCATCATCAAATGG - Intronic
1017388440 6:153912075-153912097 AGCAGCATTCTATCATCAAATGG - Intergenic
1017977100 6:159367909-159367931 AGCAGCATTCCTTCATCAAATGG - Intergenic
1018535014 6:164810346-164810368 AGCAGCATTCCATCATCAAATGG - Intergenic
1018540759 6:164876888-164876910 AGTAGCATTCCATCACCAAATGG + Intergenic
1018599905 6:165527675-165527697 AGCAGCATTCTATCATCAAATGG + Intronic
1018803773 6:167242845-167242867 AGCAGTGTTCCAGCATCAAATGG - Intergenic
1019014809 6:168872157-168872179 TACAACATTCCATAATCAAATGG - Intergenic
1020396734 7:7725662-7725684 AGCAGCATTCCATCATCAAATGG + Intronic
1020710364 7:11597773-11597795 AGCAGCATTCCATCATCAAATGG + Intronic
1021028704 7:15702292-15702314 AATAACACTCCATCATCAAATGG + Intergenic
1021372049 7:19861285-19861307 CCCAGAACTCCATCATCAAATGG - Intergenic
1021603778 7:22390840-22390862 TGCAGTCTTCCATCATAAAATGG - Intergenic
1021988830 7:26123070-26123092 AGCAGCATTCCATCAACAAATGG + Intergenic
1022078900 7:27000476-27000498 AGCAGGATTCCATCATCAAATGG + Intergenic
1022144009 7:27519060-27519082 TGCAGCATTTTATCTTCAAAAGG - Intergenic
1022548069 7:31207743-31207765 AGCAGCATCTCATTGTCAAATGG - Intergenic
1023197504 7:37657328-37657350 AGCAGCATTCTACCCTCAAGAGG - Intergenic
1023296455 7:38719980-38720002 AGCAGCAATGCAACATAAAATGG + Intergenic
1023618492 7:42045486-42045508 AGCAGAATACTATCATCAGATGG - Exonic
1024040556 7:45550292-45550314 AGCAGCATTCCATCATAAAATGG + Intergenic
1024866118 7:53906493-53906515 AGCAGCATTCCATCATCAAATGG + Intergenic
1026046473 7:66908952-66908974 AGCAGCATTCCATCATCAGATGG - Intergenic
1026207564 7:68271530-68271552 AGCAATACTCCATCATCAAATGG + Intergenic
1027799786 7:82736587-82736609 AGCATCACTTCATCATGAAATGG + Intergenic
1028043875 7:86091612-86091634 AACAGCTTTCCATCATCAAATGG + Intergenic
1028141752 7:87282130-87282152 AGCAGTATTCCATTATCAAACGG + Intergenic
1028237836 7:88382968-88382990 AGCAGCATTCCATCATCAAGTGG + Intergenic
1028360706 7:89963318-89963340 AGCAGTGCTACATCATCAAATGG - Intergenic
1029961272 7:104691195-104691217 AGCAGCATTCCATCATCTAATGG + Intronic
1030083376 7:105797089-105797111 AGCATCACTCCAGCATCAAGGGG + Intronic
1030192298 7:106821845-106821867 AGCAGCCCTCTATCATCAAATGG + Intergenic
1030277474 7:107736261-107736283 AGCAGCATTCCATCATCAAGTGG + Intergenic
1030368770 7:108674173-108674195 AGCAGCATTTCATCATCAAATGG + Intergenic
1030457445 7:109792904-109792926 AGTCACATTCCATCATCAAATGG - Intergenic
1030607833 7:111657082-111657104 AGAAGGATTCCATCTTCAGAGGG + Intergenic
1030931269 7:115525536-115525558 AGCAGCATTCCATCATCAAATGG - Intergenic
1031236843 7:119188162-119188184 AGGAGCATTCCATCATCAAATGG + Intergenic
1031474430 7:122205206-122205228 AGCAGCATTCCATCATCGGATGG - Intergenic
1031482066 7:122290042-122290064 AGCATGATTCCATTACCAAAAGG - Intergenic
1031628780 7:124021269-124021291 ACCAGCACTCCATTATCAGATGG + Intergenic
1031676574 7:124618519-124618541 AGCAGCATTCCATCATCAAATGG + Intergenic
1031767844 7:125803845-125803867 AGCAAAACTCCATCATCAGATGG + Intergenic
1031833015 7:126650170-126650192 CACAGCATTCCATCATCAAATGG + Intronic
1032153090 7:129446811-129446833 AGCAGCATTCCATCATCAAATGG - Intronic
1032318205 7:130860777-130860799 AAAAGCATTCCATCTTAAAAGGG + Intergenic
1032923457 7:136575969-136575991 AGCAGCATTCCATCATCAAATGG - Intergenic
1033729967 7:144168346-144168368 AGAAGCACTCCGTTATCAAATGG + Intergenic
1035146319 7:156821150-156821172 AGCAGCATTCCATCATCAAATGG + Intronic
1035335291 7:158124138-158124160 AGCAGCATTCCATCATCAAATGG + Intronic
1036527332 8:9547376-9547398 AGCAATACTCCATCATCAAATGG - Intergenic
1037364580 8:18108129-18108151 AGCAGCATTCCATCATCAAATGG - Intergenic
1037466444 8:19165898-19165920 AGCAGGACTCAATCATCCAAGGG + Intergenic
1038454446 8:27663492-27663514 AGCAATACTCCATCATCAGATGG - Intronic
1038823812 8:30978652-30978674 AGCAGCATTCCATTCTAAGATGG - Intergenic
1039324152 8:36466381-36466403 AGCAGCATTCCGTCATCAAATGG - Intergenic
1039626523 8:39060000-39060022 AGCAGCACCCCATCATGAAATGG - Intronic
1040711001 8:50188669-50188691 TGCAGTACTCCATTATCAAATGG - Intronic
1041246179 8:55890553-55890575 AGCAGCATTGCTGCATCATATGG - Intronic
1041380036 8:57245126-57245148 AACAGCATTCAATGATGAAATGG + Intergenic
1041543189 8:59009851-59009873 TGCAGCATTGCACCAGCAAAGGG + Intronic
1041934569 8:63321476-63321498 AGCAGCATTCCATCATCAAATGG + Intergenic
1041986197 8:63924618-63924640 AGCAGCATTCCATCATCAAATGG + Intergenic
1042001047 8:64123851-64123873 AGCAGCATTCCATCATCAAATGG - Intergenic
1042068199 8:64902060-64902082 AGCAGCACTGCATCATCAAATGG + Intergenic
1044150814 8:88773219-88773241 AGCAGCATTCCACCATCAAATGG + Intergenic
1044487132 8:92766976-92766998 AGCAGCATTCTATCATCAGATGG - Intergenic
1044633140 8:94298260-94298282 AGTAGCATTCCATCATCAAATGG - Intergenic
1045221854 8:100207211-100207233 AGCAGCCTTCCATCATCAAATGG + Intronic
1045565310 8:103308721-103308743 AACTGCATTCCATCTTCAAGTGG - Intronic
1046128659 8:109941456-109941478 AGCTGCATTTCATCATCAAATGG - Intergenic
1046197570 8:110884367-110884389 AGCAGCATTCCATCATCAAATGG + Intergenic
1046275763 8:111958076-111958098 AGCAGTACTCCTACATCAAATGG + Intergenic
1046417621 8:113937648-113937670 AGCAAAATTCCATCATCAAATGG - Intergenic
1046585770 8:116147573-116147595 AGCAGCATTCCATCATCAAATGG - Intergenic
1047453651 8:124989459-124989481 AGCAGCACTCCATCATCAAATGG + Intergenic
1047658184 8:127002023-127002045 ATCAGTAATCCACCATCAAAAGG + Intergenic
1048379338 8:133850708-133850730 AGCAACCTTCCCTGATCAAATGG - Intergenic
1048474159 8:134728222-134728244 GGCAGCCTTCCATGATCACAGGG + Intergenic
1048621055 8:136133356-136133378 AGCAGCATTCCAGAATCTGATGG - Intergenic
1048741833 8:137569235-137569257 AATATCATTCCATAATCAAATGG - Intergenic
1048746101 8:137616281-137616303 AACAGCATTCCATTTTAAAAGGG - Intergenic
1050473175 9:6014404-6014426 AGAAGGATGCCATCAACAAATGG - Exonic
1050888725 9:10796598-10796620 AGTAGCATTCCAGTATCAAATGG - Intergenic
1050901806 9:10959777-10959799 AGCAGCATTCCATCATCAAATGG + Intergenic
1051882164 9:21850808-21850830 AGCAGCATTCAGTTATCAAATGG + Intronic
1052368669 9:27640982-27641004 TGCAGCATTCCATCATCAAATGG + Intergenic
1052442250 9:28512136-28512158 AGCAGCATTGCGTCATCAAATGG - Intronic
1052895459 9:33743475-33743497 CACAGCACTCCATCATCAAATGG - Intergenic
1053025914 9:34728021-34728043 AGCTGCTCTCCATCATTAAAAGG - Exonic
1053404478 9:37860202-37860224 AGCAGCACTCCACCTTCAACAGG + Intronic
1053695946 9:40639358-40639380 AGCAGCATTCCATCATCAAATGG - Intergenic
1053868870 9:42469597-42469619 AGGAGCACTCCAGCATCTAATGG + Intergenic
1053942931 9:43270396-43270418 AGCAGCATTCCATCATCAAATGG - Intergenic
1054307193 9:63438576-63438598 AGCAGCATTCCATCATCAAATGG - Intergenic
1054405925 9:64762568-64762590 AGCAGCATTCCATCATCAAATGG - Intergenic
1054439551 9:65248055-65248077 AGCAGCATTCCATCATCAAATGG - Intergenic
1054490856 9:65773884-65773906 AGCAGCATTCCATCATCAAATGG + Intergenic
1055891918 9:81132813-81132835 AGCAGCAATCCATAATATAATGG + Intergenic
1055903923 9:81271059-81271081 AGCAGCATTTCATCATCAAGTGG - Intergenic
1056156682 9:83845355-83845377 AGCAGCATTCCATCATCAAATGG + Intronic
1056314218 9:85372799-85372821 AGCAGCATTCCATCATCAAATGG - Intergenic
1056353855 9:85778172-85778194 AGCAGCATTCCATCATCAAATGG - Intergenic
1057549909 9:96044856-96044878 GGGAGCATTCCATAATGAAATGG + Intergenic
1058019910 9:100076226-100076248 AGCAGCATTCCATCAGCAAATGG + Intronic
1058544152 9:106042604-106042626 AGCAGCATTCTATCAACAAATGG - Intergenic
1059196489 9:112375722-112375744 AGCAGTATTCCATCATCAAGTGG - Intergenic
1059755008 9:117284468-117284490 AGCAGAACTCCATCTTCACATGG - Intronic
1060178798 9:121517446-121517468 AGCAGCACTCCATCATCAAATGG + Intergenic
1060854591 9:126905145-126905167 AGCAGCAATCCATCATCAAGTGG + Intergenic
1202778393 9_KI270717v1_random:12971-12993 AGCAGCATTCCATCATCAAATGG - Intergenic
1186279514 X:7977264-7977286 AGCAGCATTCCATCATCAAATGG + Intergenic
1186384078 X:9091616-9091638 AGCAGCATTTCATCATCAAATGG - Intronic
1186469750 X:9811963-9811985 AGCAGCATTCCATCATCAAATGG - Intronic
1187498371 X:19815596-19815618 AGAACTATTCCATCTTCAAAAGG + Intronic
1187523927 X:20037276-20037298 AGCAGCATTCTATCATCAAGTGG + Intronic
1187531246 X:20098880-20098902 AGCAGCACTCCATAAACACACGG + Intronic
1188764501 X:34075371-34075393 AGCAGTACTCCATAAGCAAATGG + Intergenic
1188852087 X:35144418-35144440 AGCAGCATTCCACTATAAGATGG - Intergenic
1189105353 X:38230001-38230023 AGAAGCACTCCATTATCAAATGG + Intronic
1189154866 X:38746576-38746598 AGCAGCATTCCATCATCAAATGG - Intergenic
1190601527 X:52097712-52097734 AGCTACACACCATCATCAAATGG - Intergenic
1190953417 X:55168707-55168729 AGCCGCACTCCAGCTTCAAAGGG - Intronic
1190996732 X:55617337-55617359 AGCAGCATTCCATCATCAAATGG - Intergenic
1191047180 X:56151007-56151029 AGCAGCATTCCAGAAAAAAAGGG + Intergenic
1191095693 X:56671021-56671043 AGCAGCATCCTATCATCAAATGG - Intergenic
1191134017 X:57044343-57044365 AGTGGCATTTCATCATCAAATGG - Intergenic
1191588137 X:62851142-62851164 AGCAGCATTTCATCATCAGATGG + Intergenic
1191631312 X:63325024-63325046 AGCAGTATTCCATCATCAAATGG + Intergenic
1191658788 X:63629662-63629684 AGCAGCATTCCATCATCAAATGG - Intergenic
1191769481 X:64739953-64739975 AGCAGCATTCCAGCATCAAATGG - Intergenic
1191832713 X:65432178-65432200 AGCAGTACTCCATCATAAAATGG - Intronic
1191941245 X:66483721-66483743 AGCAGCATTCCATCGTCAAATGG - Intergenic
1191946369 X:66539156-66539178 AGCAACATTCTATCATCAAATGG + Intergenic
1192297694 X:69867879-69867901 AGCAGCATTCCATCATTAAATGG - Intronic
1192657614 X:73008827-73008849 AGCAACACTCTATCATAAAATGG - Intergenic
1192661548 X:73047617-73047639 AGCAGCATTTCATTATCAAATGG - Intergenic
1192673240 X:73168272-73168294 AGCAGCATTCCATCATCAAATGG - Intergenic
1192824501 X:74681345-74681367 ACCAGCACTCAATCACCAAATGG + Intergenic
1192996204 X:76515720-76515742 AGCCGCATTCCATTATCAAGTGG + Intergenic
1193053501 X:77125911-77125933 AGTAGCATTCCATCATCAAATGG + Intergenic
1193480249 X:82018774-82018796 AGCAGCACTCCTTAATCAAATGG + Intergenic
1193543470 X:82799121-82799143 ATCAACATTTCATCATCAAATGG + Intergenic
1193832964 X:86310241-86310263 AGCACCATTCCATCATCAAATGG + Intronic
1193876056 X:86864062-86864084 AGCAAAATTCCATCACCAAATGG + Intergenic
1193904501 X:87225975-87225997 AGAAGCATTTCATCATCAAATGG + Intergenic
1193914788 X:87351783-87351805 AGCAGCATTCCATCATCAAATGG - Intergenic
1193957302 X:87878354-87878376 AGCAGCATTCCATCATCAAATGG + Intergenic
1194010921 X:88559877-88559899 AGGGGCATTCCACCAGCAAAGGG - Intergenic
1194179576 X:90695794-90695816 AGCAGCATTCCATCATCAAATGG - Intergenic
1194232881 X:91346430-91346452 AGCAGCATTTCATCATCAAATGG + Intergenic
1194443566 X:93961247-93961269 AGCAGCATTCTATCATCAAATGG + Intergenic
1194513402 X:94822108-94822130 AGAAGCATCCCATCATCAAATGG - Intergenic
1194521097 X:94919583-94919605 AGCAGCATTTAATCATCGAATGG + Intergenic
1194566352 X:95493978-95494000 AAAAGCATTCCATTTTCAAAGGG + Intergenic
1194604363 X:95961708-95961730 TGCAGCATTCCATCATCAAATGG - Intergenic
1194626635 X:96233310-96233332 AGCAACAATTCATTATCAAATGG + Intergenic
1194649441 X:96498016-96498038 AGCAGCACTCCATCATTGAATGG + Intergenic
1194833973 X:98658947-98658969 AGCAGCATTGCATAATCAAATGG + Intergenic
1195782337 X:108479721-108479743 AGCAGCAATCCATCATCAAATGG - Intronic
1196097047 X:111811562-111811584 AGCAGCATGCCACTGTCAAAAGG + Intronic
1196135950 X:112209697-112209719 AGCAGCATTCCATCGTCAAATGG - Intergenic
1197002306 X:121453068-121453090 AGCAGCATTCCATCATCAAATGG + Intergenic
1197084185 X:122453355-122453377 AGCAGCATTCCATCATCAGATGG - Intergenic
1197367884 X:125588223-125588245 AGTAGCATTCCTGAATCAAATGG + Intergenic
1197379985 X:125727761-125727783 AGCAGCATTCCATCATCAAATGG - Intergenic
1197386757 X:125812098-125812120 AGCAGCATTCCATCACCAAATGG - Intergenic
1197477339 X:126941185-126941207 AGCAGCATTCCATCATCAAGTGG - Intergenic
1197504695 X:127287280-127287302 AACAGCATTGCATTATTAAATGG - Intergenic
1197591883 X:128419528-128419550 AGCAGCATTCCATCGTCAAATGG + Intergenic
1198783024 X:140257653-140257675 AGCAGCATTCCATCATCAAATGG - Intergenic
1198934056 X:141888023-141888045 AGCAGCATTCCATCATCAAATGG + Intronic
1199024395 X:142919863-142919885 AGCACCATTCCTTCATCACATGG + Intergenic
1199144429 X:144348821-144348843 AGCAGCTTTCCATCGTCAAATGG - Intergenic
1199240316 X:145540823-145540845 CCCAGCACTGCATCATCAAATGG + Intergenic
1199580365 X:149354317-149354339 AGCAGCACTCCATCATTAAATGG + Intergenic
1200289376 X:154857283-154857305 AATGGCACTCCATCATCAAATGG + Intronic
1200340475 X:155390498-155390520 AGCAGCATTCCATCATCAAATGG - Intergenic
1200521288 Y:4212174-4212196 AGCAGCATTCTATCATCAAATGG + Intergenic
1200526237 Y:4277963-4277985 AGCAGCATTCCATCATCAAATGG - Intergenic
1200746039 Y:6904728-6904750 AGCAGCATTCCATCATCAAATGG - Intergenic
1200973113 Y:9177566-9177588 AGCAGCATTTCATTATCAAATGG - Intergenic
1200976642 Y:9218624-9218646 AGCAGCATTTCATCACCAAATGG + Intergenic
1201193704 Y:11471274-11471296 AACAGCACTCAATCATCAAATGG - Intergenic
1201796615 Y:17903273-17903295 AGCAGCATTTCATCATGAAATGG - Intergenic
1201798444 Y:17926842-17926864 AGCAGAATTTTATCATCAAATGG + Intergenic
1201803109 Y:17979115-17979137 AGCAGAATTTTATCATCAAATGG - Intergenic
1201804940 Y:18002712-18002734 AGCAGCATTTCATCATGAAATGG + Intergenic
1202134528 Y:21647933-21647955 AGCAGTATTTCATCATCAAATGG - Intergenic
1202134947 Y:21651724-21651746 AGCAGCTTTCCTTGGTCAAATGG + Intergenic
1202357999 Y:24072335-24072357 AGCAGGATTTCATCATGAAATGG - Intergenic
1202359764 Y:24095532-24095554 AGCAGAATTTCATCATCAAATGG + Intergenic
1202511014 Y:25574582-25574604 AGCAGAATTTCATCATCAAATGG - Intergenic
1202512779 Y:25597778-25597800 AGCAGGATTTCATCATGAAATGG + Intergenic