ID: 1193957303

View in Genome Browser
Species Human (GRCh38)
Location X:87878360-87878382
Sequence ATTCCATCATCAAATGGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 996
Summary {0: 167, 1: 211, 2: 137, 3: 138, 4: 343}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193957298_1193957303 12 Left 1193957298 X:87878325-87878347 CCCATCTAACCACAAAGTGGGTC No data
Right 1193957303 X:87878360-87878382 ATTCCATCATCAAATGGAAGTGG 0: 167
1: 211
2: 137
3: 138
4: 343
1193957299_1193957303 11 Left 1193957299 X:87878326-87878348 CCATCTAACCACAAAGTGGGTCA No data
Right 1193957303 X:87878360-87878382 ATTCCATCATCAAATGGAAGTGG 0: 167
1: 211
2: 137
3: 138
4: 343
1193957301_1193957303 3 Left 1193957301 X:87878334-87878356 CCACAAAGTGGGTCATGGACAGC No data
Right 1193957303 X:87878360-87878382 ATTCCATCATCAAATGGAAGTGG 0: 167
1: 211
2: 137
3: 138
4: 343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193957303 Original CRISPR ATTCCATCATCAAATGGAAG TGG Intergenic
900434981 1:2625756-2625778 ATTCCATCATCAAATGGAAGTGG + Intronic
902666670 1:17944188-17944210 ATTTTATCATAAAATGGAAGTGG - Intergenic
902928085 1:19710549-19710571 TTCCCATCGTTAAATGGAAGTGG - Intronic
902977021 1:20096215-20096237 ATTGCATAATCAAATGGAAATGG + Intergenic
904335950 1:29798166-29798188 ATTCCATCATCAAATGGAAGTGG + Intergenic
905354084 1:37368960-37368982 ATTCCATCATCAAATGGAAGTGG + Intergenic
905465245 1:38148279-38148301 ATTGCATCATCAAATGGAAGTGG + Intergenic
906374305 1:45282196-45282218 ATTCAGTCAGCAAATGTAAGAGG - Intronic
906879689 1:49576643-49576665 GTTCCATCATCAAATGGAAGTGG + Intronic
907780360 1:57561014-57561036 ATTCCATCATCAAATGGAAGTGG + Intronic
907782924 1:57583591-57583613 ATCCCATCATTTAATGTAAGAGG - Intronic
908052331 1:60246890-60246912 ATTCCTTCATCAAATGGAAGTGG + Intergenic
908181306 1:61609074-61609096 ATTATATCCTCACATGGAAGAGG - Intergenic
908414880 1:63903361-63903383 ATGACATCATCAAGTGGGAGTGG - Intronic
908440824 1:64152026-64152048 ATTCCATAATCACTTTGAAGTGG - Intronic
908737409 1:67290993-67291015 ATTCCATCATGAAATGGAAGTGG + Intergenic
908742141 1:67339972-67339994 TTTCTATCCTCAACTGGAAGAGG - Intronic
908761609 1:67517890-67517912 GTTCCATGATAAAATGGAAATGG + Intergenic
909172589 1:72315286-72315308 ATTCCATCATCAAATGGAAGTGG - Intergenic
909233426 1:73120483-73120505 ACTCCTTCATCAAATGGAAGTGG + Intergenic
909503944 1:76366566-76366588 TATCCATGATCATATGGAAGCGG - Intronic
909542281 1:76804375-76804397 AATCCATCTTAAATTGGAAGTGG + Intergenic
909548929 1:76877003-76877025 ATCCCATCATCAAATGGAAGTGG - Intronic
909576940 1:77186038-77186060 ATTCCATCATCAAATGGAAGTGG + Intronic
909810972 1:79931516-79931538 ATTTCATCATCAAATAGAAGTGG + Intergenic
910370656 1:86512308-86512330 ATTCCATCATCAAATGGAAGTGG + Intergenic
910561918 1:88600161-88600183 ATTCCATCATCAGATGGAAATGG + Intergenic
910565658 1:88639887-88639909 ATTTCATTATTAAATGGAACTGG - Intergenic
910588231 1:88901902-88901924 ATTCCATCATCAAATGGAAGTGG + Intergenic
910630241 1:89346432-89346454 ATTCCGTCATCAAATGGAAGTGG + Intergenic
910638968 1:89439794-89439816 ATTCCACCATCAAATGGAAGTGG - Intergenic
910790342 1:91043900-91043922 ATTCCATCATCAAATGGAAGTGG + Intergenic
910831073 1:91463244-91463266 ATTCCATCATCAAATGGAGGTGG - Intergenic
910948235 1:92616888-92616910 ACTCCATCATCAAATGGAAGTGG + Intronic
911237501 1:95426948-95426970 ATTCCATGATCATGTGCAAGGGG - Intergenic
911257304 1:95647184-95647206 ATTCCATCATCTAATGGAAGTGG - Intergenic
911300582 1:96168163-96168185 ATTCTAACATGAAATGAAAGTGG - Intergenic
911738378 1:101361739-101361761 ATTCCATCACCAAATGGAAGTGG - Intergenic
911883592 1:103270634-103270656 ATTCCATCATCAAATGGAAGTGG + Intergenic
911980446 1:104559601-104559623 ATTCCATCATCATATGGAAGTGG + Intergenic
911981881 1:104579082-104579104 ATTCCTTCATCAAATGGAAGTGG - Intergenic
912045031 1:105443312-105443334 ATTTCATCATCAGATAGAAGTGG + Intergenic
912067043 1:105757135-105757157 ATTCCATCACCAAATGGAAGTGG + Intergenic
912129893 1:106587870-106587892 ATTCCATTATCAAATGGAAGTGG - Intergenic
912212272 1:107569074-107569096 ATTCCATCATCAAATGAAAGTGG + Intergenic
912271374 1:108212615-108212637 ATTCCATCTTCATATGAATGAGG - Intergenic
912636874 1:111303648-111303670 ATGCCATCAACAACTGAAAGGGG - Intronic
912725207 1:112053154-112053176 ATTCCACCATGTAATAGAAGAGG - Intergenic
912805057 1:112749478-112749500 ATTCCAACATTGAATAGAAGTGG + Intergenic
913039427 1:115008220-115008242 ACTCCATCATCAAATGGAAGTGG - Intergenic
914388896 1:147200129-147200151 GTTCCATCATGAAATGGCATTGG + Intronic
915667654 1:157459463-157459485 ATTCCATCATCAAATGGAAGTGG - Intergenic
916106312 1:161435150-161435172 ATTCCATCATCCAATCGAAGTGG - Intergenic
916240912 1:162638524-162638546 CTTCCAGCAAGAAATGGAAGTGG - Intronic
916285339 1:163099708-163099730 ATTCCATCATCAAATGGAAGTGG + Intergenic
916317166 1:163462213-163462235 ACTCCATCATGAAATGGAAGTGG + Intergenic
916369848 1:164079976-164079998 ATTCCATTGTCAAATGAAACTGG + Intergenic
916380926 1:164209784-164209806 ACTCCATCATCAAATGGAAGGGG + Intergenic
916896936 1:169173696-169173718 AATCCATCAGGAAATGGAGGGGG - Intronic
917276519 1:173337373-173337395 ACTCTATCATCAAAGGGAAGTGG + Intergenic
917462726 1:175246343-175246365 ATTCCATCATCAAATGGAAGTGG + Intergenic
917764545 1:178202189-178202211 TATCCATCGTCAAATGGAAGTGG + Intronic
918618207 1:186572615-186572637 ATTCCTACATCATATGAAAGAGG - Intergenic
918755692 1:188337629-188337651 ATTCCATCATGAAATTGAAGGGG - Intergenic
918774512 1:188610927-188610949 ATTCCATCATCAAATGGAAATGG + Intergenic
918783452 1:188732402-188732424 ATTCCATCATCAAATGGAAGCGG - Intergenic
918918213 1:190671699-190671721 ATTCCATCATCAAATGGAAGTGG - Intergenic
919264893 1:195250570-195250592 AGTCTATTATCAAATAGAAGAGG + Intergenic
919320652 1:196032597-196032619 AGTCCATTATCAAATGGAAGCGG - Intergenic
920197453 1:204238546-204238568 ATTCCATCATCAAATGGAAGTGG + Intronic
920219046 1:204382582-204382604 ATGCCACCTTCAAATGCAAGAGG - Intergenic
920321821 1:205129564-205129586 CTTCCATCTTCTACTGGAAGTGG - Intergenic
921524055 1:216195200-216195222 AATTCATCATAAAATGGAAGTGG + Intronic
921986351 1:221317099-221317121 ACTCCATCTTCAAGTGGAAATGG + Intergenic
922556873 1:226539271-226539293 GTTGCATCATCAAATGGAAATGG - Intergenic
922715639 1:227869751-227869773 TCTCCATCAGCAAAGGGAAGTGG + Intergenic
922781031 1:228252401-228252423 ATTCTATCATCAAATGGAAGTGG - Intronic
922817584 1:228461210-228461232 GATCCATCATCAAAAGTAAGTGG + Intergenic
923253548 1:232199258-232199280 ATTCCATCATCAAATGGAAGTGG - Intergenic
923822107 1:237456359-237456381 ATGCCATCATCAAATAGCAGTGG - Intronic
924391966 1:243570973-243570995 ATTCCATCATCAGAAAGAATGGG + Intronic
924491860 1:244545761-244545783 ACTCCATTATCAGATTGAAGTGG + Intronic
924630708 1:245737751-245737773 AATCCATCACCAAATGGAAATGG - Intergenic
924677446 1:246194086-246194108 ATACCATCATGAAATTTAAGAGG + Intronic
1063270575 10:4506161-4506183 ATTCTATCATCAATTGCAGGCGG + Intergenic
1064517625 10:16168076-16168098 ATTCCATTATCAAGTGGAAGTGG - Intergenic
1064519660 10:16187867-16187889 ACTCCTTCATCAAATGGAAGTGG + Intergenic
1064545671 10:16447955-16447977 ATTCCATCATCAAATGGAAGTGG - Intronic
1064600640 10:16988822-16988844 TTTCCATGACCACATGGAAGGGG - Intronic
1065005348 10:21374347-21374369 CATTCATTATCAAATGGAAGTGG + Intergenic
1065453533 10:25882907-25882929 ATTCCATTATCGAATGGGAGTGG + Intergenic
1066164075 10:32766724-32766746 ACTCCATCATCAAATAGAAGTGG + Intronic
1066167011 10:32799050-32799072 ATTCCATCATCAAATGGAAGTGG - Intronic
1066169448 10:32826498-32826520 ATTCCATCATCAAATGGAAGTGG + Intronic
1066198598 10:33125434-33125456 ATTTCTTTTTCAAATGGAAGTGG + Intergenic
1066949139 10:42096909-42096931 AAATCATCATCAAATGGAATCGG + Intergenic
1066949285 10:42098793-42098815 AAATCATCATCAAATGGAATCGG + Intergenic
1066957637 10:42188232-42188254 ATTCCATCATCAAATGGAAATGG + Intergenic
1067125533 10:43512364-43512386 ATTCCATCATCAAACGGAAGTGG - Intergenic
1067518980 10:46980632-46980654 ACTCCACCATCAAATGAAAGTGG + Intronic
1067643266 10:48071202-48071224 ACTCCACCATCAAATGAAAGTGG - Intergenic
1067754334 10:48993539-48993561 ATTCCATCATCAAGTGGAAGTGG - Intergenic
1068346813 10:55791396-55791418 AATCAATCATCAAATGGAAAAGG + Intergenic
1068396686 10:56471060-56471082 ATTCCATAATCAGACGGAAAGGG + Intergenic
1068856695 10:61805190-61805212 ATTCCATCATCAAATGGCAGTGG + Intergenic
1069010448 10:63365992-63366014 ATTCCATAATGAAATGGGAATGG + Intronic
1069192286 10:65506190-65506212 ATTCCATCATCGAATGGAAGTGG - Intergenic
1069790809 10:71019403-71019425 ATTCCATCATCAAATGGAAGTGG - Intergenic
1070860376 10:79652978-79653000 AAGCCATCAGGAAATGGAAGTGG + Intergenic
1070876889 10:79822571-79822593 AAGCCATCAGGAAATGGAAGTGG - Intergenic
1071052265 10:81465528-81465550 ATTTAATCATCTAATGCAAGTGG + Intergenic
1071267063 10:83973822-83973844 ATTCCATCATCAAATGGAAGCGG - Intergenic
1071378402 10:85033537-85033559 ATTCCATCATCAAATGGAAGTGG + Intergenic
1071521445 10:86333762-86333784 ATTCCACTATTAAGTGGAAGTGG + Intronic
1071846104 10:89522792-89522814 ATTCCATCTTCAAAAGGTTGTGG + Intronic
1071942762 10:90607598-90607620 ATTCCATCATGAAATGGAAGTGG - Intergenic
1072209240 10:93231503-93231525 CTTCCACCATCAAATGGAAGTGG - Intergenic
1072328293 10:94320259-94320281 ACTCCATTATATAATGGAAGGGG - Intronic
1072360484 10:94654327-94654349 ATTCCATCATCAAATAAAAGTGG + Intergenic
1072751690 10:97985339-97985361 ATTCCATCAGCTCATGGAACTGG - Intronic
1073557368 10:104466080-104466102 ATTTTATCATCAAATGGAAGTGG + Intergenic
1073656662 10:105424312-105424334 ATTCCATCATCAAACGGAAGTGG - Intergenic
1073918459 10:108432135-108432157 ATTCCATCATCGAGTGGAAGTGG - Intergenic
1073957665 10:108891490-108891512 ATTCCATCCTCAAATGGAAGTGG - Intergenic
1073995854 10:109314538-109314560 ATTCCATCATCAAGTGGAAGTGG - Intergenic
1074077782 10:110144706-110144728 ATTCTATCATCAAATTGAGTGGG - Intergenic
1074235638 10:111581929-111581951 ACTCCATTATCAGATGGAAATGG - Intergenic
1074632492 10:115273876-115273898 ACTCTATCATCAAATAAAAGTGG - Intronic
1074967328 10:118502763-118502785 ATTACATCATCAAATGCAATTGG + Intergenic
1075606805 10:123817578-123817600 CATTCATCATCAAATAGAAGTGG + Intronic
1075672870 10:124275780-124275802 AATCTAACATCGAATGGAAGCGG + Intergenic
1076772610 10:132674659-132674681 ATTCCATCATCAAATGGAAGTGG - Intronic
1076927396 10:133499046-133499068 ATTCCGTCATCAAATGGAAGTGG - Intergenic
1079670106 11:23158543-23158565 ATTCCATCATGAAATGGAAGTGG - Intergenic
1080020123 11:27551486-27551508 ACTCTATCATCAAGTGGAAGTGG - Intergenic
1080076613 11:28157670-28157692 ATTCCATCATCAAATGGAAGTGG + Intronic
1080235207 11:30060229-30060251 ATTCCAACATGAAAAGGAAAAGG - Intergenic
1080976695 11:37350752-37350774 ACTCCATCATCAAACGGAAGTGG + Intergenic
1081013043 11:37840302-37840324 TTCTCATCATTAAATGGAAGTGG + Intergenic
1081065441 11:38534722-38534744 ATTCCATCATCAAATGGAAGTGG - Intergenic
1081072799 11:38631275-38631297 ATTCCATCATCAAATGGAAGTGG + Intergenic
1081378305 11:42386097-42386119 ATTCCGTCATCAAATGGAAGTGG + Intergenic
1081516553 11:43837100-43837122 CTTCAACCATCAAAGGGAAGTGG - Intronic
1081609078 11:44548032-44548054 ATTCCATCATCAAATGGAAGTGG + Intergenic
1082671718 11:56043196-56043218 ATTCCATCATCAAATGGAAGTGG + Intergenic
1082920272 11:58485255-58485277 ACTCCATCATCAAATGGAAGTGG + Intergenic
1082999679 11:59280033-59280055 ATTCCATCATCAAATGGAAGTGG + Intergenic
1083093162 11:60221280-60221302 ATTCCATCATCAAATGGAAGTGG + Intronic
1084056853 11:66639552-66639574 ACACAATAATCAAATGGAAGTGG - Exonic
1084472851 11:69373309-69373331 ATTCCTGCATCAGATGGAGGAGG + Intergenic
1085590126 11:77752514-77752536 ATTCCATGGTGAAATGCAAGGGG - Intronic
1085684639 11:78610566-78610588 ACTCCATCACCAAACGGAAGTGG + Intergenic
1085685977 11:78622344-78622366 ATTCTATCATCAAGTGGAAGTGG + Intergenic
1085747588 11:79128394-79128416 ATTCCATCATCAAAAGGAAATGG + Intronic
1085852864 11:80141921-80141943 GTTCCCTCATTACATGGAAGAGG + Intergenic
1086141616 11:83506030-83506052 ATTCCATCAGCAAATGGAAGTGG - Intronic
1086278627 11:85160606-85160628 ATTCCATCAGCAAATGGAAGTGG + Intronic
1086834135 11:91600545-91600567 ATTTCAGCCTCAAATGGAAGTGG + Intergenic
1086879340 11:92135257-92135279 ACTTCGTCATTAAATGGAAGTGG - Intergenic
1087021589 11:93608577-93608599 ACTCCTTCATCAGATGGAAATGG - Intergenic
1087327826 11:96745047-96745069 ATTACTTTCTCAAATGGAAGGGG + Intergenic
1087349067 11:97008026-97008048 GTTCTATGATCAAATGGAAGAGG - Intergenic
1087882182 11:103430123-103430145 ATTCCATCATTAAATAGAGAAGG + Intronic
1088097219 11:106115312-106115334 ATTCCATCATCAAATGAAAGTGG + Intergenic
1088185143 11:107158684-107158706 GTTCCATAATAAAATGGAAATGG + Intergenic
1088191638 11:107234336-107234358 ATTCCATCATCAAATGGAAGTGG - Intergenic
1088265437 11:107983765-107983787 ATTCCATCATCAAATGGAAGTGG + Intergenic
1088407593 11:109498508-109498530 ATTCCATCATCAAATGGAAGTGG - Intergenic
1088449373 11:109965522-109965544 ATTCCATCATTAAATGGAAGTGG + Intergenic
1088836673 11:113583543-113583565 ATTCCACCATCAAATGGAAGTGG + Intergenic
1089464251 11:118674069-118674091 GTTCCATAATGAAATGGAAATGG - Intronic
1089864583 11:121620556-121620578 ATTCAATCATGACAAGGAAGTGG - Intronic
1089903627 11:122013763-122013785 ATTCCATCATTAGATGGAAGTGG + Intergenic
1090209474 11:124907896-124907918 ATTCCAAAATCAAATGGAAGTGG - Intergenic
1090891779 11:130929963-130929985 ACTCCATTACCAAATTGAAGTGG - Intergenic
1091051758 11:132378910-132378932 ATTCCATCATCAAATGGAAGTGG + Intergenic
1092012397 12:5125447-5125469 ATTTCATCATCAGATGGAAGTGG - Intergenic
1092093302 12:5821805-5821827 ATTCCATCATCAAACGTAAGTGG + Intronic
1092202317 12:6593554-6593576 CTACCATCATCAACTGGGAGCGG - Exonic
1092271802 12:7029824-7029846 ACTCCATCATCAAATGGAAGTGG + Intronic
1092381577 12:8001093-8001115 ATTCCATCATCAAATGGAAGTGG + Intergenic
1092656030 12:10686419-10686441 ACTCCATCATCAAATGGAAGTGG - Intergenic
1093036355 12:14335838-14335860 ATTCCATCATCAAATGGAAGTGG + Intergenic
1093049651 12:14490815-14490837 ATTCCATAATCAAATGGAAGTGG - Intronic
1093197953 12:16150972-16150994 ACACCATCATCAAATAGAGGAGG + Intergenic
1093392061 12:18635379-18635401 ACTCCATCATCAAATGAAATCGG - Intronic
1093645745 12:21583825-21583847 ATTGCATCAGCAAATGGAAGTGG + Intronic
1093703740 12:22251980-22252002 ATTGCATCCTCAAAAGGAACTGG - Intronic
1093964555 12:25311111-25311133 ATTCCATCATCAAATGGAAGTGG + Intergenic
1094051158 12:26222217-26222239 TTTCCATCATTGAATGGAAATGG - Intronic
1094257089 12:28444466-28444488 ATTCCATCTTAAAATGGCAGAGG - Intronic
1094389767 12:29936065-29936087 ATTCCATCATCAAATGGAAGTGG - Intergenic
1094411623 12:30173001-30173023 ATTCCGACATACAATGGAAGTGG + Intergenic
1095121490 12:38424689-38424711 ATTCCATCATCAATTGGAAGTGG - Intergenic
1095603872 12:44044479-44044501 ATTCCACCATCAAATGGAAGTGG + Intronic
1095633326 12:44402767-44402789 AGTTCATCATGAGATGGAAGTGG + Intergenic
1095738536 12:45584322-45584344 ACTCCATCATCAGATAGAAGTGG + Intergenic
1095844376 12:46729814-46729836 ATTCCATCATCAAACACAAGTGG - Intergenic
1096125733 12:49118231-49118253 ATAGAAACATCAAATGGAAGTGG - Intergenic
1096288731 12:50323115-50323137 ATTCTGTCATCATATGGAAGTGG + Intergenic
1096457443 12:51799282-51799304 ATTCCATCGTCAAATGGAAATGG - Intronic
1096734808 12:53644355-53644377 ATTGCATCATTAAATGGAAGTGG + Intronic
1096955868 12:55525537-55525559 AATCCATCATAAAATGGAAGTGG - Intergenic
1097313920 12:58151982-58152004 ACTCAGTCATCAAATGGAAATGG - Intergenic
1097691492 12:62738635-62738657 ATTTCTACAACAAATGGAAGTGG + Intronic
1097821323 12:64131709-64131731 ATTCCATCATCAAATGGAAGTGG - Intronic
1097843339 12:64342606-64342628 ATTCCATCATCAAATGGAAGTGG - Intronic
1098112960 12:67143443-67143465 ATTCGGTCATCATATGGATGTGG + Intergenic
1098158385 12:67623759-67623781 AATCCCTCGTCAAATGGAAATGG + Intergenic
1098673054 12:73254399-73254421 ATTGCATCATCAAATGGAAGTGG + Intergenic
1098716109 12:73829967-73829989 ATTTTGTCATCAGATGGAAGTGG + Intergenic
1098731070 12:74037503-74037525 ATTCCATCTTCAAAGGGAAGTGG + Intergenic
1098733310 12:74065786-74065808 ATTCCATCATCAAATGGAAGTGG + Intergenic
1098831889 12:75373870-75373892 ATTTCATCATCAAATGGAAGTGG - Intronic
1099183362 12:79492433-79492455 ATTCCATCATCAAACAGAAGTGG - Intergenic
1099365944 12:81765539-81765561 ATCCCGTCATCAAATGGAAGTGG + Intergenic
1099375666 12:81894112-81894134 ATTCCATCATCAAATGGAAGTGG + Intergenic
1099379363 12:81936386-81936408 ATTCCATCATCAAATGGAAGTGG - Intergenic
1099401186 12:82205203-82205225 ATTTCATCATTAAACGGAAGTGG - Intergenic
1099508580 12:83507342-83507364 ATTCCATCATCAAATGGAAGTGG + Intergenic
1099635488 12:85206299-85206321 ATTCCATCTACAAGTGGTAGTGG + Intronic
1099735799 12:86565195-86565217 ATTTCATCATCAAGTTGAAGTGG + Intronic
1099813716 12:87619111-87619133 ACCCTGTCATCAAATGGAAGTGG - Intergenic
1099995052 12:89769376-89769398 ATTTCATCATCAAATGTCAATGG - Intergenic
1100083322 12:90878367-90878389 ATTTCATCATCAAATGGAAGTGG + Intergenic
1100231970 12:92618006-92618028 ACTTCATCATCAAGTGGAAGTGG + Intergenic
1100241133 12:92711453-92711475 ATTTCATCATCAAATGGAAGTGG - Intergenic
1101152044 12:101891953-101891975 ATTCCATCATGCAAGGGCAGAGG - Intronic
1101243918 12:102866508-102866530 TTTCCATCCTCAACTGGATGAGG + Intronic
1101264150 12:103066277-103066299 ATTTCATCATCAAATGGAAGTGG + Intergenic
1101534650 12:105605949-105605971 ATTTCATCATCAAGTGGAACTGG - Intergenic
1101543090 12:105682791-105682813 ATTCCATTATCCAGTGGAAGTGG + Intergenic
1101572385 12:105965749-105965771 ATTCCATTATCAAATGGAACTGG - Intergenic
1101697437 12:107139676-107139698 ACTCCATCATCAGATGAAAGTGG - Intergenic
1102040790 12:109799437-109799459 ATTCCATCATCAGCTGGGCGCGG - Intronic
1103035630 12:117654229-117654251 ATTTCATCATCAAATGGAAGTGG + Intronic
1103282020 12:119766290-119766312 ATTCAACCATAAAATGGAATGGG + Intronic
1105383994 13:19913379-19913401 ATTCCATCATCAAATGGAAATGG + Intergenic
1105699950 13:22927978-22928000 ACTCTGTCATCGAATGGAAGTGG - Intergenic
1105740132 13:23315335-23315357 ATTCCATCATCAAATGGATGTGG + Intronic
1105852755 13:24350162-24350184 ACTCTGTCATCAAATGGAAGTGG - Intergenic
1106046255 13:26144877-26144899 ACTCCATTGCCAAATGGAAGTGG - Intronic
1106228186 13:27800844-27800866 ATTCTGTCACCAAAAGGAAGGGG - Intergenic
1106479896 13:30129523-30129545 ATTCCATAGACAGATGGAAGTGG + Intergenic
1107156861 13:37177829-37177851 TTTACATCATCAAATGTAAAAGG + Intergenic
1107531128 13:41283260-41283282 GTTCCATGATAAAATGGAAATGG - Intergenic
1107983556 13:45755817-45755839 ATTCCGTCATCACATGGAAGTGG - Intergenic
1108385804 13:49898361-49898383 ATTCCAACACCAAATGAGAGAGG + Intergenic
1109392337 13:61709140-61709162 ATTTAATCATCAAATGGAATTGG + Intergenic
1109460203 13:62646224-62646246 ATTCTATCATCAAATGAAGGTGG + Intergenic
1109479887 13:62937316-62937338 ATTCTATCATCACAAGGAAATGG + Intergenic
1109519040 13:63484956-63484978 ATTCCATCATCAAATGAAAGTGG + Intergenic
1109583068 13:64366321-64366343 ATTCCATCATCAAATGGAGGTGG + Intergenic
1109712665 13:66180667-66180689 ATTCCATCATCAAATGGAAGTGG - Intergenic
1109829784 13:67771918-67771940 ATTCCAACATCACATAGAAGTGG + Intergenic
1109951009 13:69502050-69502072 ATTCTGTCATCAAATGGAAGTGG - Intergenic
1110377186 13:74806624-74806646 ATTCTATCATCAAATGGAAGTGG + Intergenic
1110834118 13:80064474-80064496 ATTCCATCATCAAATGGAAGTGG - Intergenic
1111057782 13:82972872-82972894 ATTCCATCATCATATGGAAGTGG - Intergenic
1111061003 13:83018614-83018636 ACTCCATAATCAAAAAGAAGTGG - Intergenic
1111275890 13:85946361-85946383 ACTCTGTTATCAAATGGAAGTGG - Intergenic
1111326417 13:86702425-86702447 ATTCCATCTTTAAATAGAAATGG - Intergenic
1111370803 13:87313989-87314011 ACTCCATTACCAAATGGAGGTGG + Intergenic
1111470881 13:88680904-88680926 ACTCCATCACGAAATGGAAGTGG - Intergenic
1111535225 13:89595327-89595349 ATTCTATCATCAAATGGAAATGG + Intergenic
1111777290 13:92680759-92680781 ATTCCATCTTTAAAAGGTAGAGG + Intronic
1112231112 13:97590009-97590031 ATTCCATCATTAAATGGAAGTGG - Intergenic
1112249911 13:97770123-97770145 ATTCCATCATCAAATGGAAGTGG - Intergenic
1112515906 13:100052809-100052831 ATTCCTACACCAAATGTAAGCGG - Intergenic
1113111583 13:106829414-106829436 ATTATATCATCAGATGGAAGTGG - Intergenic
1113396156 13:109949687-109949709 ATTCCATTATCAAATGGAAGTGG + Intergenic
1114205886 14:20570923-20570945 ATTGCATCATCAAGTGGAAGTGG + Intergenic
1114593983 14:23895425-23895447 GTTCCATGATAAAATGGAAATGG - Intergenic
1114965592 14:27955496-27955518 ACTCCATTATCAAATGAAAATGG - Intergenic
1115059732 14:29174048-29174070 ATTCCATCATCAAATAGAAGTGG + Intergenic
1115093273 14:29604527-29604549 ATTCCATCACACAATGGAATGGG + Intronic
1115310848 14:31976342-31976364 ACTCCATCATCAGATGGAAGTGG - Intergenic
1116068111 14:40009324-40009346 ATTCGGTCATGAAATGAAAGTGG + Intergenic
1116158362 14:41236511-41236533 ATTCCATCATCAAATGGAAGTGG - Intergenic
1116308024 14:43283292-43283314 ATTCCATCATTAAATGGAAGTGG - Intergenic
1116415093 14:44669465-44669487 ATTCCGTCATCAAATGGAAGTGG + Intergenic
1116531438 14:45978073-45978095 ATTCCATCATCAAATGGAAGTGG - Intergenic
1116868995 14:50054106-50054128 TGTCATTCATCAAATGGAAGTGG - Intergenic
1117001618 14:51376467-51376489 ATTCCATCATCAAATGGAAGTGG + Intergenic
1117216861 14:53560330-53560352 ATTCCATCATCAAATGGAAGTGG + Intergenic
1117581058 14:57152156-57152178 ATTCATTCATGAAGTGGAAGTGG - Intergenic
1117596260 14:57329728-57329750 ATTCCATCATCCAATGGAAGTGG - Intergenic
1117634149 14:57724528-57724550 ATTCCATCATCAAATTGAAGTGG + Intronic
1117780093 14:59223235-59223257 ACTCCATCATCAAATGGAAGTGG - Intronic
1117782093 14:59243819-59243841 AGTCCTTCATGGAATGGAAGTGG + Intronic
1118359320 14:65042849-65042871 CTTCCAGCATGTAATGGAAGTGG - Intronic
1118385483 14:65252390-65252412 ACTCCATCATCAAATGGAAATGG - Intergenic
1119059681 14:71462035-71462057 ATTCTATCATCAAATGGAAGTGG - Intronic
1119107546 14:71938686-71938708 ATCCCATCATCAAATGGAAGTGG - Intronic
1119204936 14:72787255-72787277 ATTCTATCATCCCATGGAATAGG + Intronic
1119521586 14:75290020-75290042 ATTGCATCATCAAATAGATGGGG + Intergenic
1119950462 14:78739105-78739127 AATCCAGACTCAAATGGAAGAGG - Intronic
1120082005 14:80227375-80227397 ATTGTATCATCAAATGGAAGTGG - Intronic
1120231410 14:81845096-81845118 ATTCCATCAGCAAATGGAAGTGG - Intergenic
1120250728 14:82059521-82059543 ACTCCATCACCAAATGGAAGTGG - Intergenic
1120555972 14:85930284-85930306 ATTCCATCATCAAATGGAAGTGG - Intergenic
1120710454 14:87787945-87787967 ATTCCATTATGAAATGGAAGTGG - Intergenic
1121070548 14:91016662-91016684 ATTCCACCATCAAATGAAAGTGG + Intronic
1121854228 14:97251890-97251912 ATTCTATCATCAAGTAGCAGTGG - Intergenic
1122841449 14:104465910-104465932 ACTCTGTCATCAAATGGAAGTGG - Intergenic
1202935465 14_KI270725v1_random:83534-83556 ATTGCATCATCAAATGGAAATGG - Intergenic
1123897063 15:24839892-24839914 CTTCACTTATCAAATGGAAGTGG - Intronic
1126162820 15:45630017-45630039 ATTCCTTCAAAAAATGGAAAGGG - Intronic
1126235881 15:46383543-46383565 ACTCCATCATCATATGAAAGCGG - Intergenic
1126283626 15:46986432-46986454 ATTTCATCATCAAATGGAAGTGG + Intergenic
1128642829 15:69352382-69352404 ATTCCATCATCAAATGGAAGTGG + Intronic
1128926289 15:71659257-71659279 TTTCCATGAGCAGATGGAAGTGG - Intronic
1130525584 15:84703312-84703334 ACTCCATCATTAAGTGTAAGTGG + Intronic
1131724026 15:95202950-95202972 ATTCCACCACCGAATGGAAGTGG + Intergenic
1131887022 15:96927036-96927058 CCTCCATCATAAAATAGAAGTGG + Intergenic
1135061621 16:19275851-19275873 ACTCCTTCATCAAATGGAAGTGG - Intergenic
1135626025 16:23995650-23995672 ACTTCATCATCAAATGGAAGTGG + Intronic
1136250957 16:29004746-29004768 ATTGTATCATCAAATGGAAGTGG + Intergenic
1136749341 16:32618993-32619015 ATTCCATCACTTAATAGAAGTGG - Intergenic
1136944377 16:34629647-34629669 AATACATCATCAAATGGAATTGG - Intergenic
1137089964 16:36177173-36177195 ATTGAATCATCAAATGGAATCGG - Intergenic
1137205390 16:38111721-38111743 ATTTCATCATATAATGGTAGAGG + Intergenic
1137218147 16:46419696-46419718 GTATCATCATCAAATGGAATCGG + Intergenic
1137652745 16:50134504-50134526 ACTCCACCATCAAATGGAAGTGG - Intergenic
1138318818 16:56093603-56093625 ATTCCATCATCGAATGGAAGTGG - Intergenic
1139093684 16:63679645-63679667 ATTGCATCATAAAATGGCATAGG - Intergenic
1139134640 16:64187208-64187230 TCTTCATCATCACATGGAAGTGG + Intergenic
1141559523 16:84857883-84857905 ATTCCATCATCAAATGGAAGTGG - Intronic
1142330953 16:89453332-89453354 CTTCCAACTTAAAATGGAAGAGG + Intronic
1203051473 16_KI270728v1_random:878207-878229 ATTCCATCACTTAATAGAAGTGG - Intergenic
1143050098 17:4118208-4118230 ATTCCATCATCGAATGAAAGTGG - Intronic
1144481874 17:15636464-15636486 ACTCTCTCATCAAATGGATGAGG - Intronic
1145409391 17:22644345-22644367 AAACCATCAGGAAATGGAAGTGG - Intergenic
1146238003 17:31186104-31186126 ATTCCATCATCAAGTGGAAGTGG + Intronic
1146836375 17:36114155-36114177 ATTCCATCATCAAATGGAAGTGG + Intergenic
1146850950 17:36221195-36221217 ATTCCATCATCAAGTGGAAGTGG + Intronic
1147241709 17:39094936-39094958 TTTCCCTCATCAGAAGGAAGGGG + Intronic
1147351283 17:39847348-39847370 ATTCAAACATCAGATGGCAGAGG - Intronic
1151037793 17:70821443-70821465 ATTCCATCATCAAATGGAAGTGG - Intergenic
1151470782 17:74316457-74316479 ATTCCAGCATCAGACGGAGGGGG + Intergenic
1152419699 17:80185784-80185806 CGTCTATCATCAAAGGGAAGGGG - Intronic
1153049152 18:884835-884857 CATCCAACATCAAATGAAAGTGG + Intergenic
1153089727 18:1330312-1330334 ATTCCATCATCAAATGGAAGTGG + Intergenic
1153131256 18:1857556-1857578 ATTCCATTATCAAATGGAAGTGG - Intergenic
1153217678 18:2835452-2835474 ATTCCATCATCAAATGGAAGTGG - Intergenic
1154129517 18:11724698-11724720 ACTCCATCATCAAATGGAAGTGG - Intronic
1154252655 18:12757124-12757146 ATTCCATCATCAAATGGAAGTGG - Intergenic
1154282310 18:13015587-13015609 ATTCCATCACTTAATAGAAGTGG - Intronic
1154458737 18:14557281-14557303 ATTCCAAAGTCTAATGGAAGAGG - Intergenic
1154506190 18:15043048-15043070 ATCCAGTCATCAAATTGAAGTGG + Intergenic
1155234285 18:23803970-23803992 ATTCCGTCATCAAATGGAAGTGG - Intronic
1155336965 18:24774603-24774625 ACTCCACCATCAAACAGAAGTGG - Intergenic
1155909771 18:31494456-31494478 GTAGCATCATCAAATGGAAATGG + Intergenic
1155940774 18:31800068-31800090 ATTCCATCATCAAATGGAAGTGG + Intergenic
1156118467 18:33815881-33815903 ATTCTATCATCAAATGAAAATGG + Intergenic
1156159933 18:34347238-34347260 AATCCATTATCAAATGAAAGGGG - Intergenic
1156303878 18:35858845-35858867 ATTCCATCATCAAATGGAAGTGG + Intergenic
1156582570 18:38394615-38394637 ATTTCATCATCAAATGGAAGTGG + Intergenic
1156606389 18:38671915-38671937 ATTCCATCATTAAATGGAAGTGG + Intergenic
1156899047 18:42279168-42279190 ATTTCTTCAACAAATGGAAAAGG + Intergenic
1156990286 18:43400624-43400646 ATTCCATCATCAAATGGAAATGG - Intergenic
1156998595 18:43497880-43497902 ACCCCATCATCAAATGGAAATGG + Intergenic
1157341220 18:46780178-46780200 ATTCCATCATCAAATGGAAGTGG + Intergenic
1157690265 18:49676039-49676061 ATCCCAACATCACATGGATGGGG - Intergenic
1157870913 18:51229430-51229452 ATTTCATCATCAAATGGAAGTGG - Intergenic
1159151882 18:64532584-64532606 ATTCCATCATCAAATGGAAATGG - Intergenic
1159168853 18:64736671-64736693 ACTCTATCATCAAATGGAAGTGG + Intergenic
1159277155 18:66235676-66235698 ATTCTGTCATCACATAGAAGTGG + Intergenic
1159287803 18:66375632-66375654 ATTCCATCAACAAATGGAAGTGG + Intergenic
1159559085 18:69975213-69975235 ATTCCATCAACAAATGGAAGCGG - Intergenic
1159711314 18:71764274-71764296 ATTTCATGGTCAAATGGAAGTGG + Intronic
1159841433 18:73403568-73403590 ATTCACTTATCAAATGGAAACGG - Intergenic
1160545577 18:79651071-79651093 ATCCCATAATGAAATGGAAAAGG + Intergenic
1164117243 19:22234423-22234445 ATTCCATCATCAAATGGATGTGG - Intergenic
1164812260 19:31166558-31166580 ATTCCAGCATCCAGTGGAGGAGG - Intergenic
1165560118 19:36671862-36671884 ACTCCATCATAAAATTTAAGTGG + Intergenic
1165876255 19:39009120-39009142 ATTCCATCATAAAAAGGAATAGG - Intronic
1166283010 19:41807726-41807748 ATGATATCATCAAAGGGAAGGGG - Intronic
1167564347 19:50246960-50246982 ATTCCATCAGCACTGGGAAGAGG - Intronic
1167951599 19:53032077-53032099 ATTCCATCATCAAATGGAAATGG + Intergenic
1168539321 19:57197246-57197268 ATTCCATCATCAGATGAAAGTGG - Intronic
925279969 2:2677019-2677041 ATTCCATCATCAAATGGAAGTGG + Intergenic
925460745 2:4060597-4060619 ATTCCATCATCAAATGGAGGTGG + Intergenic
925499392 2:4486773-4486795 ATTCCATCATCTAATGGAAGTGG - Intergenic
926826779 2:16913819-16913841 ATTCCATCATCAAATGGAAGTGG + Intergenic
927660449 2:24988820-24988842 ATTCCATCATCAAATGGAAGTGG + Intergenic
927816419 2:26221530-26221552 ACTCCATTATCAAATGGAAGTGG + Intronic
927854871 2:26521717-26521739 ATTCCATCCCTAAAGGGAAGCGG + Intronic
928499849 2:31879349-31879371 ATACCAGCATTAAGTGGAAGAGG - Intronic
929269806 2:39960634-39960656 ATTCCATCATCAAGTGGAAATGG - Intergenic
929509291 2:42554282-42554304 AGTTCACCATCCAATGGAAGAGG - Intronic
930295390 2:49547358-49547380 ATTCCATCATCAAATGGAAGTGG - Intergenic
930418621 2:51121146-51121168 ACTCCATCATCAAATGGAAGTGG + Intergenic
930910167 2:56621050-56621072 ATTCCATCATCAAATGGAAGTGG + Intergenic
931025788 2:58112671-58112693 ATACCCTCTTCATATGGAAGAGG + Intronic
931128365 2:59302876-59302898 ATTGCATCATCAAATAGACATGG + Intergenic
932870689 2:75394930-75394952 ATTCCATCGTGAAAAGGAAGTGG - Intergenic
933394449 2:81713204-81713226 GTTCCAGCATCAAATGGAAGGGG - Intergenic
933504756 2:83162607-83162629 ATTCCATCATCAAATGGAAGTGG - Intergenic
934305755 2:91820746-91820768 ATTCCATCATCAAATGGAAATGG + Intergenic
934327501 2:92031996-92032018 ATTCCATCATCAAATGGAAATGG - Intergenic
934465888 2:94262575-94262597 ATTCCATCATCAAATGGAAATGG - Intergenic
934534765 2:95123694-95123716 ACTCCATCATCGAATGGAAGTGG - Intronic
934973601 2:98784615-98784637 ATTCCATCATTTACTGAAAGAGG - Intergenic
935183952 2:100715052-100715074 ATTCCATCATCAAATGGAAGTGG + Intergenic
935425089 2:102911174-102911196 ACTCCATCATCCAATGGAAGTGG - Intergenic
935507633 2:103925787-103925809 ATCCCAAAATAAAATGGAAGTGG - Intergenic
935526883 2:104181567-104181589 ACTTCACTATCAAATGGAAGTGG + Intergenic
935564295 2:104590100-104590122 ATTCCATCACCAAATGGAGGTGG - Intergenic
935843403 2:107138835-107138857 ATGGCATCACCAAAAGGAAGGGG - Intergenic
936513753 2:113168753-113168775 ATTCATTCATCAAATGGCTGTGG + Intronic
936641242 2:114314840-114314862 ATTCTACTATCAAATGGAAGTGG + Intergenic
936646271 2:114376229-114376251 ATTCCATCATCAAATGGAAGTGG - Intergenic
937531210 2:122829758-122829780 ACTCCATCATCAAATGGAAGTGG + Intergenic
937867169 2:126761214-126761236 ATTCCATCATCAACTGGAAGTGG + Intergenic
938375556 2:130803525-130803547 ACTCCATTATCAAGTGGAAGTGG + Intergenic
938709598 2:133964790-133964812 ACTCCATCATCAAATGAAAGTGG + Intergenic
938715978 2:134022207-134022229 AATCAAGCATCAAATGGAAGGGG + Intergenic
938816840 2:134913202-134913224 ATACAATCAACAAAGGGAAGAGG - Intergenic
939069081 2:137518009-137518031 ATTAAATCATCAAATGGAAGTGG + Intronic
939213889 2:139212393-139212415 ACTCCATCATCAAATGGAAGTGG + Intergenic
939633345 2:144551641-144551663 ACTCCATCATCACATAGAAGTGG - Intergenic
939725739 2:145719303-145719325 ATTTATTCATAAAATGGAAGAGG + Intergenic
939788668 2:146545960-146545982 ATTCCATCATCAAATGGAAATGG - Intergenic
939806255 2:146778627-146778649 ATTCAATCATCAAATGGAAGTGG + Intergenic
940017598 2:149123115-149123137 ATTCAGTCATCACATGGAACAGG + Intronic
940472069 2:154112974-154112996 ATTCCATCATTAAATAGAAGTGG - Intronic
940512354 2:154633132-154633154 ATACCATCATCAAATAAAAAAGG + Intergenic
940963704 2:159814245-159814267 AGTCCAGCCTCTAATGGAAGAGG + Intronic
941137939 2:161740381-161740403 GTTCCATAATAAAATGGAAATGG - Intronic
941236582 2:162982996-162983018 AGTCCATCAGAAAATGGAAATGG + Intergenic
941318658 2:164027023-164027045 TTTCCATCAGCAAATAGTAGAGG - Intergenic
941330650 2:164174412-164174434 ATTCCATCATCAAATGGAAAAGG - Intergenic
941668037 2:168261281-168261303 ATTCCATCATCAAATGGAAGTGG + Intergenic
942586394 2:177483880-177483902 ATTCCATCATTCAAAGGCAGAGG + Intronic
942987930 2:182164147-182164169 ATTCTATCGTCACATGGTAGTGG + Intronic
943006912 2:182395994-182396016 ATTCAGTCATCAAATGGAAGTGG + Intronic
943239200 2:185362419-185362441 ATTCCATCATCGAATGGAAGTGG - Intergenic
943317913 2:186412166-186412188 ATTCCATCATTAACTAGAAGTGG - Intergenic
943517578 2:188907091-188907113 AGTCCATCATCAAATGGAAGTGG - Intergenic
944106315 2:196083276-196083298 ATTCCATTTTAAAATGGAAACGG + Intergenic
944222391 2:197315618-197315640 AATTCCTCATCAAATGGAAATGG + Intergenic
945544883 2:211138296-211138318 ATTCCATCATCAAATGGAAGTGG + Intergenic
945642196 2:212443990-212444012 ATTCCATCACCAAACGGAAGTGG + Intronic
945717821 2:213380517-213380539 AGTCCTTCATCATATGAAAGTGG - Intronic
945725827 2:213471342-213471364 ATTCCATCATCAAATGGAAGTGG - Intronic
946040107 2:216775826-216775848 TTTCCCTCATCAACTGCAAGTGG - Intergenic
946488500 2:220124814-220124836 GTTCCAACTTCAAATGGAATTGG + Intergenic
946703754 2:222437639-222437661 ATTCCATCATCAAATGGAAGTGG - Intronic
946790943 2:223299913-223299935 ATTCCATCATCAAATGGAAGTGG + Intergenic
947380679 2:229542466-229542488 GTTCCATTACCAAATGAAAGCGG + Intronic
947440864 2:230120407-230120429 ATTTCATCATCAAATGGAAGTGG + Intergenic
948487752 2:238291533-238291555 ATTCCCTCTGCAAATGGAGGAGG + Intergenic
1169424998 20:5489381-5489403 AGTCTATCATCAAATGGACATGG - Intergenic
1170996179 20:21361648-21361670 ATTCCATCATCAGAAGCAAAAGG - Intronic
1171330048 20:24329486-24329508 ACTCCATCACCAATTGGAAGTGG - Intergenic
1172163248 20:32883133-32883155 ATTCCATAATAAAATGGAAATGG - Intronic
1176596887 21:8705770-8705792 ATTGCATCATCAAATGGAAATGG - Intergenic
1176815409 21:13596040-13596062 ATTCCAAAGTCTAATGGAAGAGG + Intergenic
1176998178 21:15580337-15580359 ATTCCATCATCAAATGGAAGTGG + Intergenic
1177104039 21:16932418-16932440 ATTACTTTATAAAATGGAAGTGG - Intergenic
1177139398 21:17342116-17342138 ATTCCATCATCAAATGGAAGTGG - Intergenic
1177505544 21:22014029-22014051 ATTGCATCATCAAATTGAAGTGG - Intergenic
1177821422 21:26034769-26034791 ATTCACTCATCAAATGCTAGTGG + Intronic
1177826073 21:26084562-26084584 CTTGCTTAATCAAATGGAAGAGG + Intronic
1177913194 21:27056363-27056385 ATCCCATCATCAAATGGAAGTGG + Intergenic
1177933679 21:27316779-27316801 ATTCCATCATCAAATGGAAGTGG - Intergenic
1178012678 21:28305328-28305350 ATTCCATCATAAAATAGAAATGG + Intergenic
1178060735 21:28850986-28851008 ATTCCGTTATCAGATGGAAGTGG - Intergenic
1178063285 21:28875208-28875230 ACTCTGTCATCAGATGGAAGTGG - Exonic
1178196016 21:30346062-30346084 ATTAAACCATCAAATGAAAGAGG - Intergenic
1179055489 21:37928184-37928206 GTTCCATTATAAAATGGAAATGG - Intergenic
1179415134 21:41192385-41192407 ATTCCATCATCAAATGGAAGTGG - Intronic
1180010664 21:45048500-45048522 ATGCAATCACTAAATGGAAGTGG - Intergenic
1180279809 22:10683212-10683234 ATTGCATCATCAAATGGAAATGG - Intergenic
1180587025 22:16901748-16901770 ATTCCATCATCACATGGAAATGG - Intergenic
1180591128 22:16938214-16938236 ATTCCGTCATCAAATGGAAGCGG - Intergenic
1181367419 22:22388791-22388813 ATTCCATCATTCAGTGGAAGTGG - Intergenic
1181420670 22:22795983-22796005 ATTCCATCATCAAATGGAAGTGG + Intronic
1182042770 22:27251150-27251172 CTTCCATCATTAAGGGGAAGGGG - Intergenic
1183434243 22:37784094-37784116 ATTCCAGCATTAGAAGGAAGTGG + Intergenic
1184420669 22:44381182-44381204 AGTCCATCAGCAAATGGATCTGG - Intergenic
1184603543 22:45558222-45558244 ATTCCATCATCAAATGGAAGTGG - Intronic
1184638669 22:45856884-45856906 GCTCCATCATCAACTGGAAGTGG - Intergenic
1184983510 22:48113544-48113566 ATTCCATTCTTAAATGGATGTGG - Intergenic
1203322448 22_KI270737v1_random:79855-79877 ATGGAATCATCAAATGGAATCGG + Intergenic
949170022 3:986451-986473 ACTGGATCATCAAACGGAAGTGG - Intergenic
949245883 3:1925075-1925097 ATTCCATCATCAAATGGAAGTGG + Intergenic
949417573 3:3830734-3830756 ATTCCATCATCAAATGGAAGTGG - Intronic
949445625 3:4131206-4131228 TTTCCATCATCAAATGGAAGTGG + Intronic
949638796 3:6012669-6012691 ATTCCATCATGAAATGGAGGTGG + Intergenic
949905894 3:8858209-8858231 ACTCCATCATCAAATGGAAGTGG + Intronic
951003633 3:17593004-17593026 ATTATATCATCAAATCCAAGTGG + Intronic
951122588 3:18945720-18945742 ATTCCATCATCAAATGAAAGTGG + Intergenic
951291502 3:20876593-20876615 ATTCCATCATCAAATGAAAGTGG - Intergenic
951384543 3:22027687-22027709 ATTCCATCATCAAATAGAAGTGG + Intronic
951970743 3:28441713-28441735 ATTCCATAATCAAATGGAAGTGG - Intronic
952135894 3:30419056-30419078 ATACAATCATCAAAAGGAAAAGG - Intergenic
952534136 3:34292685-34292707 ATTCCTTAATCAAATTCAAGAGG + Intergenic
952605422 3:35141863-35141885 ATTCCATCATCAAATGGAAGTGG - Intergenic
952667568 3:35925274-35925296 ATTTCATCATAAAATGAAAGAGG - Intergenic
953697905 3:45173861-45173883 AAGCCATCATAAGATGGAAGTGG - Intergenic
953804797 3:46059066-46059088 ACTCCATCATCAAATGGAAATGG + Intergenic
954054175 3:48008117-48008139 ATTCCATCATCAAATGGAAGTGG + Intronic
954511470 3:51129512-51129534 ATTACATCATCAAATGGAAGTGG - Intronic
954597733 3:51841198-51841220 AATCCATCATAAGATGGAAGTGG + Intergenic
954842155 3:53521341-53521363 ATACCATCAAGAAATTGAAGAGG - Intronic
955418624 3:58715697-58715719 ACTCCATCACCAAATGAAAGTGG - Intergenic
956509675 3:69980524-69980546 ATTCCATCATCAAATGGAAGTGG + Intergenic
956703884 3:71982735-71982757 ATTCCATCATCAGATGAAAGTGG - Intergenic
956973115 3:74550073-74550095 AATCCAGCACAAAATGGAAGTGG + Intergenic
957247562 3:77733745-77733767 ATTCCATCATTAAATGGAAGTGG - Intergenic
957744285 3:84318376-84318398 ACTGCATCACCAAATGGAAGTGG - Intergenic
957754613 3:84469578-84469600 ATTCCATCATCAAATGGACGTGG + Intergenic
957874599 3:86129454-86129476 ATGCCATCATCAAACAAAAGTGG + Intergenic
957969710 3:87366998-87367020 ACTCCTTCATCAAATGGAAGTGG - Intergenic
958485023 3:94694314-94694336 AATCCATCATAAGATGGAAATGG - Intergenic
958487659 3:94732322-94732344 ATTCCATCATCAAATGGAAGTGG - Intergenic
958630742 3:96680035-96680057 ATACAATCAACAAATTGAAGAGG - Intergenic
958845671 3:99261607-99261629 ATTCCATCATCAAATGGAAGTGG - Intergenic
958934321 3:100240779-100240801 ATTCCATCATCAAATGGAAGTGG + Intergenic
959203636 3:103279093-103279115 ATTCTATCATCAAATGAAAGTGG - Intergenic
959226764 3:103597124-103597146 ATTCCATCATCAGATGGAAGTGG - Intergenic
959745998 3:109777121-109777143 ATTCCATCACCAAATGAAAGTGG - Intergenic
959997876 3:112698472-112698494 ATTCCATCATCAAATGAAAGTGG + Intergenic
960349546 3:116575853-116575875 ATTCCATCATCAAATGGAAGTGG + Intronic
960494729 3:118360628-118360650 ATTCCATCATCAAATGGAAGTGG - Intergenic
960528475 3:118737066-118737088 ATTCCATAATCATGTGGAAATGG - Intergenic
961262865 3:125616575-125616597 ACTCCATCATCAAATAGAAGTGG + Intergenic
961858838 3:129897740-129897762 ACTCCATTATCAAATTGAAGTGG - Intergenic
963231207 3:142910353-142910375 ATTCCATCCTCAGCTGGAACTGG - Intergenic
963268097 3:143259094-143259116 ACTCCATAATTAAATGGAAATGG - Intergenic
963331798 3:143923221-143923243 ATTCCATCATCAAGTGGAAGTGG - Intergenic
963355644 3:144206709-144206731 ATTCCATCATCAAATGGAAGTGG - Intergenic
963545992 3:146658892-146658914 GCTCCATGATCAAATGGAGGTGG - Intergenic
963630323 3:147723359-147723381 ATTCCATCATCAAATGGAAGTGG + Intergenic
963661410 3:148132297-148132319 ATTCCATCATCAAATGGAAGTGG + Intergenic
963823372 3:149924422-149924444 ATTCCATCATTCAGTAGAAGAGG + Intronic
964297693 3:155252073-155252095 ACTGCATTATCAAATGGAAGTGG + Intergenic
964493680 3:157265318-157265340 CTTCCATAATAAACTGGAAGGGG + Intronic
964505851 3:157398173-157398195 ATTCCATCATCAAAGAGAAGTGG - Intronic
964679226 3:159318762-159318784 ATTCCATAATCAGATGGAAGTGG - Intronic
965226746 3:166000608-166000630 ATTCCATCATCAAATGGAAGTGG - Intergenic
965378736 3:167960802-167960824 AGTTCACCATCAAGTGGAAGAGG + Intergenic
965680435 3:171245614-171245636 TTACCATTATCAAATGGAAGAGG + Intronic
965722895 3:171680978-171681000 TTTCCAACATTTAATGGAAGAGG + Intronic
966044310 3:175530769-175530791 ATTCCATCATCAAATGGAAGTGG - Intronic
966445708 3:179998711-179998733 ATTCCATCATCAAATGAAAGTGG + Intronic
966661329 3:182418161-182418183 ACTCTATCGTCAAATGGAAGTGG + Intergenic
966896711 3:184450415-184450437 ACTCCATCATGAAACGGAAGTGG - Intronic
967570869 3:191026893-191026915 AATCCATGATGTAATGGAAGTGG - Intergenic
967831796 3:193926142-193926164 ATTCCATCAGCCAATGGAAGTGG + Intergenic
968800201 4:2738271-2738293 ATTCCATCATCAAAGAGAAGTGG + Intergenic
968906966 4:3458118-3458140 ATTCCGTCATCAAAGAGAAGTGG + Intergenic
968973267 4:3807509-3807531 ATTCCAGGATCCAATGCAAGGGG + Intergenic
969313236 4:6366514-6366536 CTTCCACCATAAAATGGAGGAGG + Intronic
970524008 4:16913221-16913243 ACTCCATTATCCAATGGAAATGG + Intergenic
970816418 4:20161464-20161486 ACTCCATCATTAAATAGAAGTGG + Intergenic
971817246 4:31505227-31505249 CGTCCATCATCAAATGAAAGTGG + Intergenic
971857634 4:32062681-32062703 ATTCCATCATCAGATGCAAGTGG - Intergenic
971897552 4:32617162-32617184 ACTTCATCATCAAATGTAAGTGG + Intergenic
972095513 4:35342841-35342863 ATTCTATTATGAAATGGAAGTGG + Intergenic
972177413 4:36425339-36425361 ATTCCATCTTCAAATGACATTGG + Intergenic
972201290 4:36717033-36717055 ATTCCATCATCAAATGGAAATGG - Intergenic
972805933 4:42529480-42529502 ACTGCATCATCAAATTGAAGTGG + Intronic
972882944 4:43448002-43448024 ATTACATCATCAACTGGAAGTGG - Intergenic
973098072 4:46226913-46226935 ACTCCATTATCAAATAAAAGTGG + Intergenic
973118461 4:46489203-46489225 ATTCCATCATCAAATGGAAGTGG + Intergenic
973120969 4:46520746-46520768 ATTCCTTTATCAAATGGAAGTGG - Intergenic
973130173 4:46639546-46639568 ATTCCATCATTAAATGGAAGTGG - Intergenic
973140867 4:46766391-46766413 ACTTCATCATCAAATGTCAGGGG + Intronic
973539851 4:51924930-51924952 ACTCCAACATCAAATGGAAGTGG - Intergenic
973975244 4:56256622-56256644 ACTCCATCATCAAATGGAAGTGG + Intronic
974243567 4:59283873-59283895 ATTCCATTATCAAATGGAAGAGG - Intergenic
974289586 4:59912894-59912916 ATTCCATCATTAAATGGAAGTGG + Intergenic
974479024 4:62420684-62420706 ATTCCATCATCAAATGGAAGTGG - Intergenic
974564806 4:63568464-63568486 ATTCCGTAATCAAATAGAAGTGG + Intergenic
974644597 4:64674613-64674635 ATTCCATCATCAAATGGAAGTGG - Intergenic
974727231 4:65812674-65812696 ATTCCGTCATCAAATGGAAGTGG + Intergenic
974746901 4:66088753-66088775 ATTCTATCTTCAAATGGAAGTGG - Intergenic
975024480 4:69531784-69531806 GCTCTATCATCAAATGGAAGTGG + Intergenic
975051336 4:69868353-69868375 ACTTCATCACCAAATGGAAGTGG + Intergenic
975386701 4:73767357-73767379 ATTCCATCATTAAATGGAAGTGG - Intergenic
975760916 4:77618854-77618876 ATACCATGTTCAAATTGAAGAGG + Intergenic
975982595 4:80177128-80177150 ATTCCATCATCAAATGTAGGTGG - Intergenic
976034194 4:80795670-80795692 ATTCCATCATCAAATAGAAGTGG - Intronic
977031636 4:91891559-91891581 ATTCCATCATCAAATGGAAGTGG + Intergenic
977089448 4:92652069-92652091 ACTGCATCTTCAAATGGAAATGG - Intronic
977204726 4:94155789-94155811 ATTCCGTCATCAAATGGAAGTGG + Intergenic
977220168 4:94328361-94328383 AGTCCCTCATCAAAATGAAGTGG - Intronic
977466017 4:97383526-97383548 ATTTCATCATCAAATGGAAGTGG + Intronic
977490054 4:97699919-97699941 ATTCTCTCATTAAATGAAAGTGG - Intronic
977626255 4:99192502-99192524 ATCCCATCATCAAATGGAAGTGG - Intergenic
977701717 4:100029735-100029757 ATTACATTATTAAATGGAAGTGG - Intergenic
977753104 4:100633145-100633167 ACTCCATCATCAAATGGTAGTGG - Intronic
977833257 4:101618016-101618038 ATTCCATTATCAAATGGAAGTGG - Intronic
977845018 4:101758247-101758269 ACTCCATCATCAAACAGAAAAGG + Intronic
977847080 4:101779069-101779091 ACTACATCATCAAGTGGAAGTGG - Intronic
977898720 4:102394740-102394762 ATTCCATCATCAAATGGAAGTGG + Intronic
977930393 4:102743667-102743689 ATTCCCTCATCAAATGGAAGTGG - Intronic
978341575 4:107725397-107725419 ATTCCATCAGCAAATGGAAGTGG - Intergenic
978899057 4:113926666-113926688 ATTCCATCATCAAATGTAAGTGG - Intronic
979345876 4:119586323-119586345 ATTCTATGATCAAAAGCAAGTGG + Intronic
979595632 4:122531311-122531333 ATTCTATTATCAAATGAAAGTGG + Intergenic
979595719 4:122532025-122532047 ATTCTATTATCAAATGAAAGTGG - Intergenic
979725011 4:123950614-123950636 ATTCCTTCATCAAATTTAATGGG - Intergenic
979879406 4:125936121-125936143 ATACAATCAACAAAGGGAAGTGG + Intergenic
980385771 4:132086879-132086901 ATTCCATCATTAAATGGAAGTGG - Intergenic
980387928 4:132111029-132111051 ATTTCATCATCAAATGGAAGTGG - Intergenic
980497513 4:133605210-133605232 ATTCCATCATCAAATGTAAGTGG - Intergenic
980659655 4:135840969-135840991 ATTCCATCATCAAACAGAAGTGG + Intergenic
980697759 4:136381888-136381910 ACTCCATCATGAAATGGAATTGG + Intergenic
980822971 4:138040140-138040162 ACTCCATCATCAGATGGAACTGG - Intergenic
980957749 4:139446069-139446091 ATTCCATCATCAAATGGAAGTGG + Intergenic
981306619 4:143253632-143253654 AGTCTATCATCAAATGTAAATGG + Intergenic
981462826 4:145031950-145031972 ATTCCATTATCAAATGGAAGTGG + Intronic
981567690 4:146117771-146117793 ATTCCAGCATCTCAGGGAAGGGG + Intergenic
981700979 4:147607305-147607327 ATTCCATTGTAAAATGGAAATGG - Intergenic
981832963 4:149023164-149023186 ATCCCCTCATCAAATGGAAATGG + Intergenic
981835019 4:149044097-149044119 ATTCCATCATCAAATGAAAGTGG + Intergenic
982597759 4:157406879-157406901 ATTCCATAACCAAATGGAAGTGG - Intergenic
982623322 4:157732749-157732771 ATTCCAACATCAAATGGAAGTGG - Intergenic
982835561 4:160116793-160116815 ATTCCATCATCAAATGGAAGTGG + Intergenic
982847789 4:160274451-160274473 ATTCCATTGTCAAATGGAAGCGG + Intergenic
983027409 4:162755447-162755469 ATTCCATTATTGAATGTAAGTGG + Intergenic
983185081 4:164691726-164691748 ATTCCATCATCAAATGGAAGTGG + Intergenic
983339053 4:166434605-166434627 ACTCCATCATCAAATGAACATGG + Intergenic
983582696 4:169324964-169324986 ATTTCATCATCAAATGGAAGTGG + Intergenic
986025592 5:3847566-3847588 ATTCTATTATCAAATGGAAGTGG + Intergenic
986087127 5:4462870-4462892 ATTCCATCATCAAATGGAAGTGG + Intergenic
986938315 5:12918598-12918620 ATTCCATCATCAAATGGAAGTGG - Intergenic
987466249 5:18275424-18275446 ATTCCATCATCAAATGGAAGTGG - Intergenic
987504401 5:18749989-18750011 ATTCCATCATCAAATGAAAGTGG + Intergenic
987578326 5:19758159-19758181 GTTCTATCATCAAATAGAAGTGG - Intronic
987657121 5:20821499-20821521 ATTCCATCATCAAATGACAGTGG - Intergenic
987753252 5:22068158-22068180 ACCCCATCATCAAATGAAAGTGG + Intronic
987885463 5:23806652-23806674 ATTCCATCATCAAATGGAAGTGG + Intergenic
988079808 5:26401268-26401290 ATTCCATCATCAAATGGAAGTGG - Intergenic
988107774 5:26772699-26772721 ATTACATCATCAAATGGAAGTGG + Intergenic
988160807 5:27516718-27516740 TTTCCATCATCAAATGAAAGTGG - Intergenic
988169185 5:27632685-27632707 ATTCCATCATCAAATAAAAGTGG - Intergenic
988228784 5:28448278-28448300 ATTCCATCATCAAATAGAAGTGG + Intergenic
988233271 5:28506937-28506959 ATTCCATCATCAAATGGAAGTGG - Intergenic
988258191 5:28848693-28848715 ACTCCATCATCAAATGGAAGGGG + Intergenic
988562149 5:32290996-32291018 ATTCCATCATCAAATGGAAGTGG + Intronic
988766430 5:34382449-34382471 ATTCCATCATCAAATGACAGTGG + Intergenic
989045190 5:37267436-37267458 ATTCCATCATCAAACAGAAGTGG - Intergenic
989097844 5:37797472-37797494 ATTCCATCATCAAATGGAAGAGG + Intergenic
989140859 5:38200064-38200086 GTTCCACCATCAAATGCAAGTGG + Intergenic
989186949 5:38635192-38635214 ATTCCATAACAAAATGGAAATGG + Intergenic
989307485 5:39974470-39974492 ATTGCATCATCAAATGGAGTTGG - Intergenic
989486366 5:41996206-41996228 ATTCCATCATCAAATGGAAGTGG - Intergenic
989823909 5:45830691-45830713 ATTGCATCTTAAAATGGAATAGG + Intergenic
990635124 5:57716938-57716960 ATTATATCATAAAATGGTAGGGG + Intergenic
990644911 5:57833163-57833185 ATTCCATCATCACATGGGCATGG + Intergenic
990762587 5:59146542-59146564 GTTTCATCAAGAAATGGAAGTGG + Intronic
991013785 5:61910736-61910758 ATTCCATCATCAAATGGAAGTGG - Intergenic
991033560 5:62106075-62106097 ATTCTATCACCAAATGGAAGTGG + Intergenic
991330720 5:65489532-65489554 ATTCCATCATCAAATCGAAGTGG - Intergenic
992109861 5:73482724-73482746 AGCCCATCATCAAATAGAAGTGG - Intergenic
992242972 5:74790020-74790042 ATTCCATCATCAAATTGAAGTGG + Intronic
992624717 5:78626616-78626638 TCTCCATCATCAACTGGCAGGGG + Intronic
993153944 5:84197733-84197755 ATTGCATCATGAAGTGCAAGAGG + Intronic
993203412 5:84847693-84847715 ATCTCATCATCAAATGGAGGTGG + Intergenic
993231884 5:85247379-85247401 ATTCCATCATCAAATGGAAGTGG - Intergenic
993372424 5:87109154-87109176 ATGCCAATATAAAATGGAAGAGG + Intergenic
993412563 5:87591659-87591681 ATTCCATCATCAAATGGAAGTGG - Intergenic
993780710 5:92062545-92062567 ATTCCATCATCCAATGGAAGTGG + Intergenic
994291354 5:98031818-98031840 ATTCCATGATCACATGGAAGTGG - Intergenic
994447325 5:99894406-99894428 ATTAAATCATCAAAAGCAAGTGG + Intergenic
994734814 5:103539433-103539455 ATTCCATAATAAAGTGAAAGAGG - Intergenic
994855418 5:105113431-105113453 ATTCTGTCATTAAATGGAAGTGG - Intergenic
994984399 5:106915576-106915598 ATTCCATCATCAAATGGAAGTGG - Intergenic
995269536 5:110205312-110205334 ATTTCATAATTAAATGGAAGTGG - Intergenic
995407562 5:111817299-111817321 AGTGCATCATTGAATGGAAGTGG + Intronic
995427717 5:112043573-112043595 ATTTCATCATAAAATGGAAGTGG - Intergenic
995577872 5:113560403-113560425 TTTCCTTCATCAAATACAAGAGG - Intronic
995776267 5:115727546-115727568 ATTCCATCGTCAAATGGAAGGGG - Intergenic
995824862 5:116284569-116284591 ATTCCATTATCTAATGACAGTGG + Intronic
997179422 5:131813036-131813058 ACTCCATTATCAAATGGAAGTGG + Intronic
997213222 5:132090059-132090081 AATCCATCATAAGATGGAAGTGG - Intergenic
998290317 5:140908398-140908420 ATTCCATCATCAAATGGAAGTGG - Intronic
999351404 5:150874998-150875020 ATTCCATCATCAAATGGAAGTGG + Intronic
999932201 5:156445899-156445921 ATTCCTTCACCAAATGTCAGGGG + Intronic
1000422824 5:161057663-161057685 ACTATGTCATCAAATGGAAGTGG - Intergenic
1000904160 5:166943286-166943308 ATCCCATTAATAAATGGAAGAGG + Intergenic
1001173615 5:169444797-169444819 ATTCCATCATCAAATGGAAGTGG + Intergenic
1001439425 5:171728717-171728739 ATTCCACCTTTTAATGGAAGTGG - Intergenic
1001513548 5:172339503-172339525 AATCCATCATCAAGTCGGAGGGG - Exonic
1001991267 5:176117493-176117515 ATTCCATCACTTAATAGAAGTGG - Intronic
1002225608 5:177720643-177720665 ATTCCATCACTTAATAGAAGTGG + Intronic
1002268241 5:178050562-178050584 ATTCCATCACTTAATAGAAGTGG - Intronic
1002997983 6:2304899-2304921 ATACCATCTCCAAATGAAAGTGG + Intergenic
1003695883 6:8405986-8406008 ATTCCATCATCAAATTGAAGTGG - Intergenic
1003758627 6:9150235-9150257 ATTCCATCATCAAATGGAAGTGG + Intergenic
1003791244 6:9550198-9550220 ATTCCATCATCAAAGGGAAGTGG + Intergenic
1004013788 6:11713702-11713724 AATCAATGTTCAAATGGAAGAGG + Intronic
1004824273 6:19403082-19403104 ATTCCATCATCAAATGGAAGTGG - Intergenic
1004931157 6:20464417-20464439 GTTCTATCATAAAATGGAAATGG - Intronic
1005185188 6:23157226-23157248 ATTCCATCATCAAATGGAAGTGG + Intergenic
1005234212 6:23741039-23741061 ACTCCATCAACAAATAGAAATGG - Intergenic
1005578179 6:27209457-27209479 GTTCCATTATCAAATGGAAATGG + Intergenic
1006062366 6:31433376-31433398 ATTCCATCATCAAATGGAAGTGG + Intergenic
1007710190 6:43817924-43817946 GTTCCATAATAAAATGGAAATGG + Intergenic
1008266905 6:49439135-49439157 ATTCCATCATCAAATGGAAGTGG - Intronic
1008400305 6:51055618-51055640 ATTCCATCATCAAATGGAAGTGG + Intergenic
1008485683 6:52032795-52032817 TTTCCATCATGAAAAGGATGTGG - Intronic
1008548232 6:52602704-52602726 TTTAAATCATCAAATGTAAGTGG + Intergenic
1008735771 6:54542009-54542031 AGTCCACCATTAAATGGAAGTGG + Intergenic
1008820418 6:55625303-55625325 ATTCCATCATCGAATGGAAGTGG + Intergenic
1009308655 6:62122461-62122483 ATTCCGTCATCAAATGGAAGTGG + Intronic
1009390095 6:63134924-63134946 ATTCCATCATTAAATGGAAGTGG - Intergenic
1009806512 6:68607098-68607120 GTTCCATCATCAAATGGAAGTGG + Intergenic
1009851907 6:69208804-69208826 ATTCCATCATCAAATGGAAGTGG - Intronic
1010058308 6:71590450-71590472 GTTCATTCATCAAATGGAAGAGG + Intergenic
1010107986 6:72190758-72190780 ATTCCATCATCAAATGGAAGTGG - Intronic
1010323597 6:74540642-74540664 ATTCCATCATCAAATGGAAGTGG + Intergenic
1010338016 6:74711732-74711754 TATCCATCATCACATGGATGTGG - Intergenic
1010580741 6:77593759-77593781 AATCCATCATCAAATGGAAGTGG - Intergenic
1010590229 6:77703779-77703801 ATCCCATTATCAAATTGAAAAGG + Intronic
1011039329 6:83013121-83013143 ATTCTGTCATCAAATGGAAGTGG - Intronic
1011069122 6:83361819-83361841 ATTCCATCATCAAATGGAAGTGG + Intronic
1011136575 6:84106786-84106808 ACTCCATCATCAAATGGAAATGG - Intergenic
1011361654 6:86532064-86532086 ATCACTTTATCAAATGGAAGTGG + Intergenic
1012001977 6:93665076-93665098 ATTTCATCATCAAATGGATGTGG + Intergenic
1012226108 6:96704976-96704998 ACCCCATCATCAAATGGAAGTGG + Intergenic
1012324258 6:97895381-97895403 ATTTAATAAGCAAATGGAAGTGG - Intergenic
1012344604 6:98170473-98170495 ATTCCATCATCAAATGGAAGTGG + Intergenic
1012730481 6:102874471-102874493 ATACCATCATCAAATGGAAGTGG + Intergenic
1012920778 6:105219391-105219413 ATTTCATCATCAAATGGAAGTGG - Intergenic
1013406688 6:109849956-109849978 ATTCTATCATCAAATGGAAGTGG + Intergenic
1013929548 6:115514660-115514682 ATTCCAACCTCAAGTGGACGGGG - Intergenic
1014059380 6:117052577-117052599 AGTCCATCATAAGATGGGAGTGG - Intergenic
1014067240 6:117141896-117141918 ATTCCATCCTCAGATGGAAAAGG - Intergenic
1014096874 6:117470717-117470739 GTTCCATAATAAAATGGAAATGG - Intronic
1014363379 6:120508201-120508223 ATTCCATCATCAAATGGATGTGG - Intergenic
1014416001 6:121185387-121185409 ACTCCATCATCAAGTGAAAGTGG - Intronic
1014534176 6:122596452-122596474 ATTCCATCATCAAATGGAAGTGG - Intronic
1014538811 6:122649606-122649628 ACCCCAATATCAAATGGAAGTGG - Intronic
1015035846 6:128653113-128653135 ATTCCATTATCAAACTGAAGTGG - Intergenic
1015095434 6:129409447-129409469 CTTCCATCATCAACTGTAAGTGG - Intronic
1015466829 6:133557562-133557584 ATTCCTTCATCAAATGGAAGTGG - Intergenic
1015475765 6:133657637-133657659 ATTCCATCATCAAATGGAAGTGG + Intergenic
1016101889 6:140113318-140113340 ATTACATCATAACATGGCAGAGG + Intergenic
1016144308 6:140649556-140649578 ATCCCATCATCAAATGGAAGTGG + Intergenic
1016147312 6:140692562-140692584 ATTCCATCATCAAATGGAAGCGG - Intergenic
1016576241 6:145572434-145572456 CATCCATCATCAAATGGAAGTGG - Intronic
1016842414 6:148537730-148537752 ATTCCAACATCAAAAGGTAGTGG - Intronic
1017044049 6:150330700-150330722 ACTCCATCATCAAATGGAAGGGG - Intergenic
1017227792 6:152040938-152040960 ATTCCATCATCAAATGGAAGTGG - Intronic
1017321657 6:153101514-153101536 ATTCCTTCATAAAATGGAACTGG + Intronic
1017388439 6:153912069-153912091 ATTCTATCATCAAATGGAAGTGG - Intergenic
1017452331 6:154565700-154565722 ATACCGCCATCAAATGGGAGTGG + Intergenic
1017938234 6:159026101-159026123 ATTCCATCATGAGATAGCAGTGG + Intergenic
1017977099 6:159367903-159367925 ATTCCTTCATCAAATGGAAGTGG - Intergenic
1018122910 6:160655069-160655091 ATTTCATCATCAAATTGAAGTGG - Intronic
1018535013 6:164810340-164810362 ATTCCATCATCAAATGGAAGTGG - Intergenic
1018599906 6:165527681-165527703 ATTCTATCATCAAATGGAAGTGG + Intronic
1018803772 6:167242839-167242861 GTTCCAGCATCAAATGGAAGTGG - Intergenic
1018955041 6:168403845-168403867 ACTCCATCCTCAAATGGAAGGGG - Intergenic
1019892126 7:3955195-3955217 ATTCCATGAACAACTTGAAGGGG - Intronic
1020396735 7:7725668-7725690 ATTCCATCATCAAATGGAAGTGG + Intronic
1020710365 7:11597779-11597801 ATTCCATCATCAAATGGACGTGG + Intronic
1021028705 7:15702298-15702320 ACTCCATCATCAAATGGAAGTGG + Intergenic
1021862277 7:24917911-24917933 ATTCCATTATCAAATAGATTTGG - Intronic
1021988831 7:26123076-26123098 ATTCCATCAACAAATGGAAGTGG + Intergenic
1022078901 7:27000482-27000504 ATTCCATCATCAAATGGAAGTGG + Intergenic
1023309648 7:38871356-38871378 ATTGCATCTTCACATGGAAAGGG + Intronic
1023645229 7:42305383-42305405 ATTCCTTCAACACATGGATGTGG - Intergenic
1024040557 7:45550298-45550320 ATTCCATCATAAAATGGAAGTGG + Intergenic
1024159153 7:46656590-46656612 ACTCCATCATCAAATGAAGGTGG - Intergenic
1024430251 7:49280244-49280266 ATTTCATCATAAAATGGTTGTGG - Intergenic
1024744224 7:52388576-52388598 CTTCCATGATCAAATAGAAGTGG + Intergenic
1024872538 7:53982772-53982794 ACTCCACCATAAAATTGAAGAGG - Intergenic
1024884325 7:54124493-54124515 ATCAAATCATCAAATGGAAGTGG - Intergenic
1025322513 7:58111766-58111788 GTATCATCATCAAATGGAATCGG - Intergenic
1026046471 7:66908946-66908968 ATTCCATCATCAGATGGAGGTGG - Intergenic
1026207565 7:68271536-68271558 ACTCCATCATCAAATGGAAGTGG + Intergenic
1027685815 7:81278108-81278130 ATTTCATCATCAAATGAAAGTGG + Intergenic
1027906525 7:84191438-84191460 ATTCCATCATCCAATGTAAGGGG - Intronic
1028128741 7:87145877-87145899 ATTCCAGCATCATATGAAAATGG + Intergenic
1028141753 7:87282136-87282158 ATTCCATTATCAAACGGAAGTGG + Intergenic
1028237837 7:88382974-88382996 ATTCCATCATCAAGTGGAAGTGG + Intergenic
1028935031 7:96455216-96455238 ATTCTGTCATCAAATTGTAGAGG + Intergenic
1029424462 7:100487297-100487319 ATTCCATTCTCAAAAGGAATTGG + Intronic
1029961273 7:104691201-104691223 ATTCCATCATCTAATGGAAGTGG + Intronic
1030004074 7:105097999-105098021 ATTCCATCATCACATGATAGAGG + Intronic
1030277475 7:107736267-107736289 ATTCCATCATCAAGTGGAAGTGG + Intergenic
1030368771 7:108674179-108674201 ATTTCATCATCAAATGGAAGTGG + Intergenic
1030457444 7:109792898-109792920 ATTCCATCATCAAATGGAAGTGG - Intergenic
1030931268 7:115525530-115525552 ATTCCATCATCAAATGGAAGTGG - Intergenic
1031236844 7:119188168-119188190 ATTCCATCATCAAATGGCAGTGG + Intergenic
1031482065 7:122290036-122290058 ATTCCATTACCAAAAGGAAGTGG - Intergenic
1031676575 7:124618525-124618547 ATTCCATCATCAAATGGAAGTGG + Intergenic
1031682056 7:124687511-124687533 ATTCCATCATTAAACAGAAGTGG + Intergenic
1031767845 7:125803851-125803873 ACTCCATCATCAGATGGAAGTGG + Intergenic
1032150849 7:129428278-129428300 ACAGAATCATCAAATGGAAGAGG - Exonic
1032153089 7:129446805-129446827 ATTCCATCATCAAATGGAAGTGG - Intronic
1033017642 7:137688110-137688132 TTTCCAACATCAAATGGGAATGG + Intronic
1033076276 7:138253198-138253220 GTTCCATCATCAAATTGAAGTGG + Intergenic
1033449232 7:141448089-141448111 ATTCAGTCATCAAAGGCAAGCGG - Intronic
1034357239 7:150460821-150460843 ACTCCATCATCCAATGGAAGTGG - Intronic
1035146320 7:156821156-156821178 ATTCCATCATCAAATGGAAGTGG + Intronic
1035335292 7:158124144-158124166 ATTCCATCATCAAATGGAAGTGG + Intronic
1037157025 8:15714351-15714373 ATGCCATCATCAAAAGATAGAGG + Intronic
1037229966 8:16646175-16646197 ATTCCAGAAGCAAAAGGAAGAGG + Intergenic
1037364579 8:18108123-18108145 ATTCCATCATCAAATGGAAGTGG - Intergenic
1037922449 8:22816860-22816882 ATTCAATAATCAAATGCAACTGG + Intronic
1038454445 8:27663486-27663508 ACTCCATCATCAGATGGAAGTGG - Intronic
1038604576 8:28986591-28986613 ATTCTCTCTCCAAATGGAAGAGG + Intronic
1038851252 8:31279207-31279229 ACTCCATAATCAAGTGGAAAAGG - Intergenic
1039373018 8:37005514-37005536 CTTCCTTCAGCAAAAGGAAGTGG + Intergenic
1039671161 8:39600772-39600794 ATTTCACAATCAATTGGAAGGGG + Intronic
1040711000 8:50188663-50188685 ACTCCATTATCAAATGGAAGTGG - Intronic
1040911963 8:52528570-52528592 ATTCCATCATCAAATGTAAGTGG + Intergenic
1041378069 8:57222488-57222510 ACTCCATTACCAAAAGGAAGAGG - Intergenic
1041714248 8:60919824-60919846 GCTGCATCATCACATGGAAGGGG + Intergenic
1041828006 8:62119898-62119920 ATTCAATAATGTAATGGAAGAGG + Intergenic
1041986198 8:63924624-63924646 ATTCCATCATCAAATGGAAGTGG + Intergenic
1042001046 8:64123845-64123867 ATTCCATCATCAAATGGAAGTGG - Intergenic
1042068200 8:64902066-64902088 ACTGCATCATCAAATGGAAGTGG + Intergenic
1042342442 8:67694503-67694525 CCTCCATCATCAAATGGAAGTGG + Intronic
1043251270 8:78076746-78076768 ATTCCATGATTAAAAGGAATTGG + Intergenic
1043259953 8:78184041-78184063 ATTCCATCATCAAATGTAAGTGG - Intergenic
1043341771 8:79248510-79248532 ATTTCATCATCAAATGAAAATGG + Intergenic
1043800355 8:84601898-84601920 ATTCCAAAATCAAAAGTAAGTGG - Intronic
1044017811 8:87067118-87067140 AGTGCATCATTATATGGAAGAGG - Intronic
1044192198 8:89332304-89332326 ATTTCACCACTAAATGGAAGTGG - Intergenic
1044202409 8:89452640-89452662 ATTCTGTCATCAAATAGGAGTGG + Intergenic
1044487131 8:92766970-92766992 ATTCTATCATCAGATGGACGTGG - Intergenic
1044622595 8:94204842-94204864 ATCCCAGCATTGAATGGAAGGGG + Intronic
1044633139 8:94298254-94298276 ATTCCATCATCAAATGGAAGTGG - Intergenic
1045221856 8:100207217-100207239 CTTCCATCATCAAATGGAAGTGG + Intronic
1045422700 8:102032164-102032186 ACTCCGTCACCAAGTGGAAGTGG + Intronic
1045436666 8:102171237-102171259 AATCCTTCATAAGATGGAAGTGG + Intergenic
1045618603 8:103948221-103948243 TTTACATCAGCAAATGGATGAGG - Intronic
1046128658 8:109941450-109941472 ATTTCATCATCAAATGGAAGTGG - Intergenic
1046197571 8:110884373-110884395 ATTCCATCATCAAATGGAAGTGG + Intergenic
1046275764 8:111958082-111958104 ACTCCTACATCAAATGGAAGTGG + Intergenic
1046363046 8:113186641-113186663 GTTCCATAATAAAATGGAAATGG - Intronic
1046417620 8:113937642-113937664 ATTCCATCATCAAATGGAAGTGG - Intergenic
1046585768 8:116147567-116147589 ATTCCATCATCAAATGGAGGTGG - Intergenic
1046677051 8:117121302-117121324 ATTCAATCTTAAAAAGGAAGGGG + Intronic
1047751618 8:127885239-127885261 ATTCTCACATCAAATGGAAGAGG - Intergenic
1048339865 8:133530105-133530127 ATTCAATTATCAAATGTCAGTGG - Intronic
1050482690 9:6102753-6102775 ATTCCATCATCAAATGAAAGTGG + Intergenic
1050486996 9:6145101-6145123 ACTTCATTATCAAGTGGAAGTGG - Intergenic
1050518815 9:6475470-6475492 TTTCCATCTGCAAATGAAAGGGG - Exonic
1050888724 9:10796592-10796614 ATTCCAGTATCAAATGGAAGTGG - Intergenic
1050901807 9:10959783-10959805 ATTCCATCATCAAATGGAAGTGG + Intergenic
1051306282 9:15713471-15713493 ACTCTATCATCAAATGAAAGTGG - Intronic
1051519378 9:17968197-17968219 ATTGCATCATGAGATGGAGGAGG - Intergenic
1051882165 9:21850814-21850836 ATTCAGTTATCAAATGGAAATGG + Intronic
1051971260 9:22890391-22890413 ACTCCATTATCAAATGGAAGTGG - Intergenic
1052101006 9:24446264-24446286 ACTCCATCATCAAATAGAAGTGG - Intergenic
1052227604 9:26108528-26108550 ATTCCATCATCAAAAAGAAGTGG + Intronic
1052251133 9:26398344-26398366 ATTCCATCAGCAAGGGAAAGGGG - Intergenic
1052368670 9:27640988-27641010 ATTCCATCATCAAATGGAAGTGG + Intergenic
1052555546 9:30010864-30010886 ATTCTTTCATCATATGGATGTGG - Intergenic
1052561510 9:30089604-30089626 ATTCCATTATCAAATGAAAGTGG - Intergenic
1052577254 9:30306133-30306155 ACTCCAACATCAAATGAAAATGG + Intergenic
1052730397 9:32278539-32278561 ATCCCATTATCAGAGGGAAGAGG - Intergenic
1053042347 9:34885374-34885396 ATCCCATCATCAGAAGGAGGAGG - Intergenic
1053610835 9:39711581-39711603 ACTCCAGCATTTAATGGAAGTGG + Intergenic
1053695945 9:40639352-40639374 ATTCCATCATCAAATGGAAATGG - Intergenic
1053868871 9:42469603-42469625 ACTCCAGCATCTAATGGAAGTGG + Intergenic
1053942930 9:43270390-43270412 ATTCCATCATCAAATGGAAATGG - Intergenic
1054087419 9:60759577-60759599 ACTCCAGCATTTAATGGAAGTGG - Intergenic
1054242687 9:62630814-62630836 ACTCCAGCATTTAATGGAAGTGG - Intergenic
1054307192 9:63438570-63438592 ATTCCATCATCAAATGGAAATGG - Intergenic
1054405924 9:64762562-64762584 ATTCCATCATCAAATGGAAATGG - Intergenic
1054439550 9:65248049-65248071 ATTCCATCATCAAATGGAAATGG - Intergenic
1054490857 9:65773890-65773912 ATTCCATCATCAAATGGAAATGG + Intergenic
1054556811 9:66665332-66665354 ACTCCAGCATTTAATGGAAGTGG - Intergenic
1055223500 9:73966553-73966575 AGTCCATCAGCAATTGTAAGTGG + Intergenic
1055903922 9:81271053-81271075 ATTTCATCATCAAGTGGAAGTGG - Intergenic
1055933302 9:81581632-81581654 CTTCCAAAATCAAATAGAAGTGG + Intergenic
1056030348 9:82546860-82546882 GTTGCATCATCACATGGCAGAGG - Intergenic
1056314217 9:85372793-85372815 ATTCCATCATCAAATGGAAGTGG - Intergenic
1057059020 9:91986739-91986761 ACTCCATCATCAGATAGAAGTGG + Intergenic
1057295726 9:93838076-93838098 ATTTCTTCATCAAATAGATGTGG + Intergenic
1057549910 9:96044862-96044884 ATTCCATAATGAAATGGAAATGG + Intergenic
1058544151 9:106042598-106042620 ATTCTATCAACAAATGGAAGTGG - Intergenic
1059893381 9:118831808-118831830 ACTCTGTCATCAAATGGAAGTGG + Intergenic
1060178799 9:121517452-121517474 ACTCCATCATCAAATGGAAGTGG + Intergenic
1060854592 9:126905151-126905173 AATCCATCATCAAGTGGAAATGG + Intergenic
1062383668 9:136299679-136299701 ATTTGCTCAACAAATGGAAGGGG - Intronic
1202778392 9_KI270717v1_random:12965-12987 ATTCCATCATCAAATGGAAATGG - Intergenic
1203531950 Un_GL000213v1:153401-153423 ATTCCAAAGTCTAATGGAAGAGG - Intergenic
1185848170 X:3459641-3459663 ATTCCATCGTCAAATCCAACAGG - Intergenic
1186279515 X:7977270-7977292 ATTCCATCATCAAATGGAAGTGG + Intergenic
1186469749 X:9811957-9811979 ATTCCATCATCAAATGGAAGTGG - Intronic
1187523928 X:20037282-20037304 ATTCTATCATCAAGTGGAAATGG + Intronic
1187604885 X:20872014-20872036 ATTCCATCATTGAATGATAGTGG + Intergenic
1187880367 X:23841545-23841567 ACTCCATCATCAAGTGGATGTGG - Intronic
1188764502 X:34075377-34075399 ACTCCATAAGCAAATGGAAGTGG + Intergenic
1188895902 X:35668036-35668058 ATACCTTCATCATAGGGAAGAGG - Intergenic
1188907987 X:35811115-35811137 ATTCCATCAGAAAAAGAAAGTGG + Intergenic
1189105354 X:38230007-38230029 ACTCCATTATCAAATGGAAGAGG + Intronic
1189154865 X:38746570-38746592 ATTCCATCATCAAATGGAAGTGG - Intergenic
1189510319 X:41655541-41655563 GTTCCATAATAAAATGGAAATGG + Intronic
1189516093 X:41714843-41714865 CTTCCATAATAAAATGGAAATGG + Intronic
1190009996 X:46776155-46776177 CTTCCATCAAGAAATGGAATCGG - Intergenic
1190601526 X:52097706-52097728 ACACCATCATCAAATGGAAATGG - Intergenic
1190638429 X:52459269-52459291 ATTGAATCATCAAATAGAAGCGG + Intergenic
1190678228 X:52801175-52801197 ATTGAATCATCAAATAGAAGCGG - Intergenic
1190721616 X:53153461-53153483 GCTCCATCACCAAATGGAAGTGG - Intergenic
1190864167 X:54370663-54370685 GTTCCATAATGAAATGGAAATGG - Intergenic
1191009333 X:55744485-55744507 ACTCCATCACCAAATTAAAGCGG - Intronic
1191134016 X:57044337-57044359 ATTTCATCATCAAATGGAAGTGG - Intergenic
1191588138 X:62851148-62851170 ATTTCATCATCAGATGGAAGTGG + Intergenic
1191626256 X:63274536-63274558 ATTTCTTCATAAAATGGGAGGGG - Intergenic
1191630020 X:63312437-63312459 ATTCCATCATCAAATGAAAGTGG - Intergenic
1191658787 X:63629656-63629678 ATTCCATCATCAAATGGAAGTGG - Intergenic
1191719222 X:64215558-64215580 ATTCCATCATCAAATGAAAGTGG - Intergenic
1191832712 X:65432172-65432194 ACTCCATCATAAAATGGAAGTGG - Intronic
1191919697 X:66241865-66241887 ATGACATAAACAAATGGAAGAGG + Intronic
1191932939 X:66394314-66394336 ATTCCATCATGAACTGGAAGTGG + Intergenic
1191941242 X:66483715-66483737 ATTCCATCGTCAAATGGAAGGGG - Intergenic
1191946370 X:66539162-66539184 ATTCTATCATCAAATGGAAGTGG + Intergenic
1192047081 X:67687026-67687048 ATTCCATTTCCAAATCGAAGTGG - Intronic
1192297693 X:69867873-69867895 ATTCCATCATTAAATGGAAGTGG - Intronic
1192381129 X:70617784-70617806 ACTCCATAATAAAATGGAAGTGG + Intronic
1192474361 X:71426899-71426921 ATTCCTTAAACAAATAGAAGAGG + Intronic
1192531672 X:71892991-71893013 ACTCCATTGTCAAATGGAAGAGG - Intergenic
1192657613 X:73008821-73008843 ACTCTATCATAAAATGGAAGTGG - Intergenic
1192661547 X:73047611-73047633 ATTTCATTATCAAATGGAAGTGG - Intergenic
1192673239 X:73168266-73168288 ATTCCATCATCAAATGGAAGTGG - Intergenic
1192996206 X:76515726-76515748 ATTCCATTATCAAGTGGAAGTGG + Intergenic
1193053502 X:77125917-77125939 ATTCCATCATCAAATGGAAGTGG + Intergenic
1193297802 X:79852824-79852846 ATTCCATCATCAAATAAAAGTGG + Intergenic
1193356272 X:80523273-80523295 ATTCCATCATCAAATTGAAGTGG + Intergenic
1193904502 X:87225981-87226003 ATTTCATCATCAAATGGAAGTGG + Intergenic
1193914787 X:87351777-87351799 ATTCCATCATCAAATGGAAGTGG - Intergenic
1193957303 X:87878360-87878382 ATTCCATCATCAAATGGAAGTGG + Intergenic
1194072270 X:89340463-89340485 ACTACATCATCAAGTAGAAGTGG - Intergenic
1194232882 X:91346436-91346458 ATTTCATCATCAAATGGAAGTGG + Intergenic
1194343326 X:92731234-92731256 GTTCCATCATCAAATGAAAGTGG + Intergenic
1194443567 X:93961253-93961275 ATTCTATCATCAAATGGAAGTGG + Intergenic
1194480322 X:94414400-94414422 ATTCTAACATCAAATGGAAGTGG - Intergenic
1194482738 X:94446699-94446721 ACTTAATCATCAAATGGAAGTGG + Intergenic
1194513401 X:94822102-94822124 ATCCCATCATCAAATGGAAGTGG - Intergenic
1194604233 X:95960826-95960848 CTTTCATCATGAAATGGCAGAGG - Intergenic
1194604362 X:95961702-95961724 ATTCCATCATCAAATGGAAGTGG - Intergenic
1194626636 X:96233316-96233338 AATTCATTATCAAATGGAAGTGG + Intergenic
1194716567 X:97293019-97293041 ATTCCCTAATTAAATGAAAGAGG + Intronic
1194833974 X:98658953-98658975 ATTGCATAATCAAATGGTATTGG + Intergenic
1194849226 X:98852024-98852046 ATTCCATCATCAAATAAAGGTGG - Intergenic
1195761876 X:108255215-108255237 AAGGCATCCTCAAATGGAAGTGG + Intronic
1195782336 X:108479715-108479737 AATCCATCATCAAATGGAAGTGG - Intronic
1195809767 X:108816698-108816720 ATTCCATCATCAAATGTAAGTGG - Intergenic
1196135949 X:112209691-112209713 ATTCCATCGTCAAATGGAAGTGG - Intergenic
1196194501 X:112825498-112825520 ATTCCAACTTGGAATGGAAGTGG - Intronic
1197002309 X:121453074-121453096 ATTCCATCATCAAATGGAAGGGG + Intergenic
1197044436 X:121978460-121978482 GGTACATCATCAAAGGGAAGTGG + Intergenic
1197084184 X:122453349-122453371 ATTCCATCATCAGATGGAAGCGG - Intergenic
1197182114 X:123547933-123547955 ATCCCATCATCAAATGGAAGTGG + Intergenic
1197245031 X:124158843-124158865 ATTCCATCATCACATGGAAGTGG - Intronic
1197379984 X:125727755-125727777 ATTCCATCATCAAATGGAAGTGG - Intergenic
1197386756 X:125812092-125812114 ATTCCATCACCAAATGGAAGTGG - Intergenic
1197405100 X:126039350-126039372 TTTCCGTAATCAAATGGAAGTGG + Intergenic
1197477338 X:126941179-126941201 ATTCCATCATCAAGTGGAAGTGG - Intergenic
1197522012 X:127510516-127510538 ATTCCATCATCAAATGAAAGTGG + Intergenic
1197591884 X:128419534-128419556 ATTCCATCGTCAAATGGAAGTGG + Intergenic
1198170022 X:134096404-134096426 GCTCCATCATCAAATGGAAGTGG + Intergenic
1198340123 X:135705835-135705857 ACACCATTATTAAATGGAAGTGG + Intergenic
1198343598 X:135738573-135738595 ACACCATTATTAAATGGAAGTGG + Intergenic
1198701317 X:139400446-139400468 ATTCCATCATCAAATTGAAGTGG + Intergenic
1198783023 X:140257647-140257669 ATTCCATCATCAAATGGAAGTGG - Intergenic
1199024397 X:142919869-142919891 ATTCCTTCATCACATGGAAGTGG + Intergenic
1199040609 X:143111249-143111271 ACTCCATCATGAAAGGAAAGTGG + Intergenic
1199144428 X:144348815-144348837 TTTCCATCGTCAAATGGAAGTGG - Intergenic
1199240318 X:145540829-145540851 ACTGCATCATCAAATGGAAATGG + Intergenic
1199310410 X:146314250-146314272 GTTCCATCATCAAATAAAAGTGG - Intergenic
1199580366 X:149354323-149354345 ACTCCATCATTAAATGGAAGTGG + Intergenic
1200289377 X:154857289-154857311 ACTCCATCATCAAATGGAAGTGG + Intronic
1200340474 X:155390492-155390514 ATTCCATCATCAAATGGAAGTGG - Intergenic
1200651683 Y:5847899-5847921 ATTCCATCATCAAATGAAAGTGG + Intergenic
1200726512 Y:6676214-6676236 ACTACATCATCAAGTAGAAGTGG - Intergenic
1200727664 Y:6691990-6692012 ACTACATCATCAAGTAGAAGTGG - Intergenic
1200746037 Y:6904722-6904744 ATTCCATCATCAAATGGAGGTGG - Intergenic
1200910992 Y:8531275-8531297 ATGCCACCCTCCAATGGAAGTGG - Intergenic
1200973112 Y:9177560-9177582 ATTTCATTATCAAATGGAAGTGG - Intergenic
1200976643 Y:9218630-9218652 ATTTCATCACCAAATGGAAGTGG + Intergenic
1201398901 Y:13581420-13581442 GCATCATCATCAAATGGAAGTGG + Intergenic
1201529636 Y:14977740-14977762 ATTCTATCATCAAATGAAAGTGG - Intergenic
1201796614 Y:17903267-17903289 ATTTCATCATGAAATGGATGTGG - Intergenic
1201798445 Y:17926848-17926870 ATTTTATCATCAAATGGAAGTGG + Intergenic
1201803108 Y:17979109-17979131 ATTTTATCATCAAATGGAAGTGG - Intergenic
1201804941 Y:18002718-18002740 ATTTCATCATGAAATGGATGTGG + Intergenic
1202134527 Y:21647927-21647949 ATTTCATCATCAAATGGAAGTGG - Intergenic
1202137969 Y:21686953-21686975 ATTTCATTATCAATTGGAAGTGG + Intergenic
1202357998 Y:24072329-24072351 ATTTCATCATGAAATGGATGTGG - Intergenic
1202359765 Y:24095538-24095560 ATTTCATCATCAAATGGAAGTGG + Intergenic
1202511013 Y:25574576-25574598 ATTTCATCATCAAATGGAAGTGG - Intergenic
1202512780 Y:25597784-25597806 ATTTCATCATGAAATGGATGTGG + Intergenic