ID: 1193957305

View in Genome Browser
Species Human (GRCh38)
Location X:87878370-87878392
Sequence CAAATGGAAGTGGTTGTGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193957299_1193957305 21 Left 1193957299 X:87878326-87878348 CCATCTAACCACAAAGTGGGTCA No data
Right 1193957305 X:87878370-87878392 CAAATGGAAGTGGTTGTGATTGG No data
1193957301_1193957305 13 Left 1193957301 X:87878334-87878356 CCACAAAGTGGGTCATGGACAGC No data
Right 1193957305 X:87878370-87878392 CAAATGGAAGTGGTTGTGATTGG No data
1193957298_1193957305 22 Left 1193957298 X:87878325-87878347 CCCATCTAACCACAAAGTGGGTC No data
Right 1193957305 X:87878370-87878392 CAAATGGAAGTGGTTGTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193957305 Original CRISPR CAAATGGAAGTGGTTGTGAT TGG Intergenic
No off target data available for this crispr