ID: 1193964942

View in Genome Browser
Species Human (GRCh38)
Location X:87973691-87973713
Sequence CTAGGTTTTTCCAGTTCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193964941_1193964942 -10 Left 1193964941 X:87973678-87973700 CCAAAGATGTTTTCTAGGTTTTT No data
Right 1193964942 X:87973691-87973713 CTAGGTTTTTCCAGTTCTACTGG No data
1193964939_1193964942 19 Left 1193964939 X:87973649-87973671 CCACAAAGTGGACAACTTTCTGT No data
Right 1193964942 X:87973691-87973713 CTAGGTTTTTCCAGTTCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193964942 Original CRISPR CTAGGTTTTTCCAGTTCTAC TGG Intergenic