ID: 1193964942 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:87973691-87973713 |
| Sequence | CTAGGTTTTTCCAGTTCTAC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1193964941_1193964942 | -10 | Left | 1193964941 | X:87973678-87973700 | CCAAAGATGTTTTCTAGGTTTTT | No data | ||
| Right | 1193964942 | X:87973691-87973713 | CTAGGTTTTTCCAGTTCTACTGG | No data | ||||
| 1193964939_1193964942 | 19 | Left | 1193964939 | X:87973649-87973671 | CCACAAAGTGGACAACTTTCTGT | No data | ||
| Right | 1193964942 | X:87973691-87973713 | CTAGGTTTTTCCAGTTCTACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1193964942 | Original CRISPR | CTAGGTTTTTCCAGTTCTAC TGG | Intergenic | ||