ID: 1193972425

View in Genome Browser
Species Human (GRCh38)
Location X:88071618-88071640
Sequence CACATTTACATCACTGTACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193972425_1193972427 13 Left 1193972425 X:88071618-88071640 CCAAGTACAGTGATGTAAATGTG No data
Right 1193972427 X:88071654-88071676 ACAAGAAACCTTATAAACAAAGG No data
1193972425_1193972428 14 Left 1193972425 X:88071618-88071640 CCAAGTACAGTGATGTAAATGTG No data
Right 1193972428 X:88071655-88071677 CAAGAAACCTTATAAACAAAGGG No data
1193972425_1193972431 21 Left 1193972425 X:88071618-88071640 CCAAGTACAGTGATGTAAATGTG No data
Right 1193972431 X:88071662-88071684 CCTTATAAACAAAGGGAATCGGG No data
1193972425_1193972429 20 Left 1193972425 X:88071618-88071640 CCAAGTACAGTGATGTAAATGTG No data
Right 1193972429 X:88071661-88071683 ACCTTATAAACAAAGGGAATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193972425 Original CRISPR CACATTTACATCACTGTACT TGG (reversed) Intergenic
No off target data available for this crispr