ID: 1193972431

View in Genome Browser
Species Human (GRCh38)
Location X:88071662-88071684
Sequence CCTTATAAACAAAGGGAATC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193972425_1193972431 21 Left 1193972425 X:88071618-88071640 CCAAGTACAGTGATGTAAATGTG No data
Right 1193972431 X:88071662-88071684 CCTTATAAACAAAGGGAATCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193972431 Original CRISPR CCTTATAAACAAAGGGAATC GGG Intergenic
No off target data available for this crispr