ID: 1193972448

View in Genome Browser
Species Human (GRCh38)
Location X:88071988-88072010
Sequence TAATCCCATATACTTATACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193972448_1193972452 25 Left 1193972448 X:88071988-88072010 CCAAGTATAAGTATATGGGATTA No data
Right 1193972452 X:88072036-88072058 AATTTTTGTATTTTCAGTAAAGG 0: 8
1: 371
2: 5233
3: 6170
4: 6176
1193972448_1193972453 30 Left 1193972448 X:88071988-88072010 CCAAGTATAAGTATATGGGATTA No data
Right 1193972453 X:88072041-88072063 TTGTATTTTCAGTAAAGGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193972448 Original CRISPR TAATCCCATATACTTATACT TGG (reversed) Intergenic
No off target data available for this crispr