ID: 1193972449

View in Genome Browser
Species Human (GRCh38)
Location X:88072021-88072043
Sequence CAAAAATTAGCTAGGCATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 557677
Summary {0: 1253, 1: 45091, 2: 121441, 3: 194165, 4: 195727}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193972449_1193972453 -3 Left 1193972449 X:88072021-88072043 CCACCATGCCTAGCTAATTTTTG 0: 1253
1: 45091
2: 121441
3: 194165
4: 195727
Right 1193972453 X:88072041-88072063 TTGTATTTTCAGTAAAGGCGAGG No data
1193972449_1193972455 20 Left 1193972449 X:88072021-88072043 CCACCATGCCTAGCTAATTTTTG 0: 1253
1: 45091
2: 121441
3: 194165
4: 195727
Right 1193972455 X:88072064-88072086 TTTCACCATATTGGCCAGACTGG 0: 384
1: 14801
2: 118777
3: 166160
4: 167445
1193972449_1193972454 11 Left 1193972449 X:88072021-88072043 CCACCATGCCTAGCTAATTTTTG 0: 1253
1: 45091
2: 121441
3: 194165
4: 195727
Right 1193972454 X:88072055-88072077 AAGGCGAGGTTTCACCATATTGG No data
1193972449_1193972452 -8 Left 1193972449 X:88072021-88072043 CCACCATGCCTAGCTAATTTTTG 0: 1253
1: 45091
2: 121441
3: 194165
4: 195727
Right 1193972452 X:88072036-88072058 AATTTTTGTATTTTCAGTAAAGG 0: 8
1: 371
2: 5233
3: 6170
4: 6176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193972449 Original CRISPR CAAAAATTAGCTAGGCATGG TGG (reversed) Intergenic
Too many off-targets to display for this crispr