ID: 1193972450

View in Genome Browser
Species Human (GRCh38)
Location X:88072024-88072046
Sequence ATACAAAAATTAGCTAGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 372634
Summary {0: 1223, 1: 44183, 2: 89209, 3: 121515, 4: 116504}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193972450_1193972454 8 Left 1193972450 X:88072024-88072046 CCATGCCTAGCTAATTTTTGTAT 0: 1223
1: 44183
2: 89209
3: 121515
4: 116504
Right 1193972454 X:88072055-88072077 AAGGCGAGGTTTCACCATATTGG No data
1193972450_1193972453 -6 Left 1193972450 X:88072024-88072046 CCATGCCTAGCTAATTTTTGTAT 0: 1223
1: 44183
2: 89209
3: 121515
4: 116504
Right 1193972453 X:88072041-88072063 TTGTATTTTCAGTAAAGGCGAGG No data
1193972450_1193972455 17 Left 1193972450 X:88072024-88072046 CCATGCCTAGCTAATTTTTGTAT 0: 1223
1: 44183
2: 89209
3: 121515
4: 116504
Right 1193972455 X:88072064-88072086 TTTCACCATATTGGCCAGACTGG 0: 384
1: 14801
2: 118777
3: 166160
4: 167445

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193972450 Original CRISPR ATACAAAAATTAGCTAGGCA TGG (reversed) Intergenic
Too many off-targets to display for this crispr