ID: 1193972453

View in Genome Browser
Species Human (GRCh38)
Location X:88072041-88072063
Sequence TTGTATTTTCAGTAAAGGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193972449_1193972453 -3 Left 1193972449 X:88072021-88072043 CCACCATGCCTAGCTAATTTTTG 0: 1253
1: 45091
2: 121441
3: 194165
4: 195727
Right 1193972453 X:88072041-88072063 TTGTATTTTCAGTAAAGGCGAGG No data
1193972448_1193972453 30 Left 1193972448 X:88071988-88072010 CCAAGTATAAGTATATGGGATTA No data
Right 1193972453 X:88072041-88072063 TTGTATTTTCAGTAAAGGCGAGG No data
1193972450_1193972453 -6 Left 1193972450 X:88072024-88072046 CCATGCCTAGCTAATTTTTGTAT 0: 1223
1: 44183
2: 89209
3: 121515
4: 116504
Right 1193972453 X:88072041-88072063 TTGTATTTTCAGTAAAGGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193972453 Original CRISPR TTGTATTTTCAGTAAAGGCG AGG Intergenic
No off target data available for this crispr