ID: 1193979184

View in Genome Browser
Species Human (GRCh38)
Location X:88159897-88159919
Sequence ATGGAGACTCAGAATGATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193979184_1193979191 28 Left 1193979184 X:88159897-88159919 CCACCATCATTCTGAGTCTCCAT No data
Right 1193979191 X:88159948-88159970 ATAAAGCAGGCAGGAGAAGATGG 0: 53
1: 85
2: 167
3: 406
4: 1118
1193979184_1193979188 0 Left 1193979184 X:88159897-88159919 CCACCATCATTCTGAGTCTCCAT No data
Right 1193979188 X:88159920-88159942 CATCTAATTATCTGGCAGCGTGG No data
1193979184_1193979186 -8 Left 1193979184 X:88159897-88159919 CCACCATCATTCTGAGTCTCCAT No data
Right 1193979186 X:88159912-88159934 GTCTCCATCATCTAATTATCTGG No data
1193979184_1193979190 19 Left 1193979184 X:88159897-88159919 CCACCATCATTCTGAGTCTCCAT No data
Right 1193979190 X:88159939-88159961 GTGGCTAGAATAAAGCAGGCAGG No data
1193979184_1193979189 15 Left 1193979184 X:88159897-88159919 CCACCATCATTCTGAGTCTCCAT No data
Right 1193979189 X:88159935-88159957 CAGCGTGGCTAGAATAAAGCAGG 0: 24
1: 148
2: 250
3: 343
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193979184 Original CRISPR ATGGAGACTCAGAATGATGG TGG (reversed) Intergenic
No off target data available for this crispr