ID: 1194001094

View in Genome Browser
Species Human (GRCh38)
Location X:88429429-88429451
Sequence AGCATCAATGAGGATATTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194001094_1194001096 -2 Left 1194001094 X:88429429-88429451 CCATCAATATCCTCATTGATGCT No data
Right 1194001096 X:88429450-88429472 CTACAGCTTCTCTTAAACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194001094 Original CRISPR AGCATCAATGAGGATATTGA TGG (reversed) Intergenic
No off target data available for this crispr