ID: 1194001688

View in Genome Browser
Species Human (GRCh38)
Location X:88437616-88437638
Sequence CTGAATACATAAATGGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194001686_1194001688 8 Left 1194001686 X:88437585-88437607 CCTTTTAAAATGCTCTGGACACA No data
Right 1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG No data
1194001683_1194001688 17 Left 1194001683 X:88437576-88437598 CCTCCAGCTCCTTTTAAAATGCT No data
Right 1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG No data
1194001684_1194001688 14 Left 1194001684 X:88437579-88437601 CCAGCTCCTTTTAAAATGCTCTG No data
Right 1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194001688 Original CRISPR CTGAATACATAAATGGACAA TGG Intergenic
No off target data available for this crispr