ID: 1194008448

View in Genome Browser
Species Human (GRCh38)
Location X:88527734-88527756
Sequence CTTAAGGCCAATAATTATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194008448_1194008451 22 Left 1194008448 X:88527734-88527756 CCATCATAATTATTGGCCTTAAG No data
Right 1194008451 X:88527779-88527801 CCAATACCTCTAGTTCTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194008448 Original CRISPR CTTAAGGCCAATAATTATGA TGG (reversed) Intergenic
No off target data available for this crispr