ID: 1194010229

View in Genome Browser
Species Human (GRCh38)
Location X:88553065-88553087
Sequence CAGACTGAAATGTCTTAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194010229_1194010232 -3 Left 1194010229 X:88553065-88553087 CCCATTTAAGACATTTCAGTCTG No data
Right 1194010232 X:88553085-88553107 CTGATTAAGAACCATTGCTAGGG No data
1194010229_1194010235 16 Left 1194010229 X:88553065-88553087 CCCATTTAAGACATTTCAGTCTG No data
Right 1194010235 X:88553104-88553126 AGGGAGACAGTGTGGTTCTTTGG No data
1194010229_1194010231 -4 Left 1194010229 X:88553065-88553087 CCCATTTAAGACATTTCAGTCTG No data
Right 1194010231 X:88553084-88553106 TCTGATTAAGAACCATTGCTAGG 0: 2
1: 67
2: 163
3: 267
4: 423
1194010229_1194010234 8 Left 1194010229 X:88553065-88553087 CCCATTTAAGACATTTCAGTCTG No data
Right 1194010234 X:88553096-88553118 CCATTGCTAGGGAGACAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194010229 Original CRISPR CAGACTGAAATGTCTTAAAT GGG (reversed) Intergenic
No off target data available for this crispr