ID: 1194011696

View in Genome Browser
Species Human (GRCh38)
Location X:88569671-88569693
Sequence GAGGGTATACACTTTATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194011688_1194011696 8 Left 1194011688 X:88569640-88569662 CCCCTTAGGATTAACTGGGTAGA No data
Right 1194011696 X:88569671-88569693 GAGGGTATACACTTTATGGATGG No data
1194011682_1194011696 26 Left 1194011682 X:88569622-88569644 CCTTGGCTACCCAGGGAGCCCCT No data
Right 1194011696 X:88569671-88569693 GAGGGTATACACTTTATGGATGG No data
1194011685_1194011696 16 Left 1194011685 X:88569632-88569654 CCAGGGAGCCCCTTAGGATTAAC No data
Right 1194011696 X:88569671-88569693 GAGGGTATACACTTTATGGATGG No data
1194011680_1194011696 28 Left 1194011680 X:88569620-88569642 CCCCTTGGCTACCCAGGGAGCCC No data
Right 1194011696 X:88569671-88569693 GAGGGTATACACTTTATGGATGG No data
1194011689_1194011696 7 Left 1194011689 X:88569641-88569663 CCCTTAGGATTAACTGGGTAGAT No data
Right 1194011696 X:88569671-88569693 GAGGGTATACACTTTATGGATGG No data
1194011690_1194011696 6 Left 1194011690 X:88569642-88569664 CCTTAGGATTAACTGGGTAGATA No data
Right 1194011696 X:88569671-88569693 GAGGGTATACACTTTATGGATGG No data
1194011684_1194011696 17 Left 1194011684 X:88569631-88569653 CCCAGGGAGCCCCTTAGGATTAA No data
Right 1194011696 X:88569671-88569693 GAGGGTATACACTTTATGGATGG No data
1194011681_1194011696 27 Left 1194011681 X:88569621-88569643 CCCTTGGCTACCCAGGGAGCCCC No data
Right 1194011696 X:88569671-88569693 GAGGGTATACACTTTATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194011696 Original CRISPR GAGGGTATACACTTTATGGA TGG Intergenic
No off target data available for this crispr