ID: 1194013820

View in Genome Browser
Species Human (GRCh38)
Location X:88594758-88594780
Sequence TTGGAAAAATAAATGGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194013813_1194013820 15 Left 1194013813 X:88594720-88594742 CCACACACTTACAACCAGTTAAC No data
Right 1194013820 X:88594758-88594780 TTGGAAAAATAAATGGGGGAAGG No data
1194013812_1194013820 26 Left 1194013812 X:88594709-88594731 CCAAAATAAAGCCACACACTTAC No data
Right 1194013820 X:88594758-88594780 TTGGAAAAATAAATGGGGGAAGG No data
1194013814_1194013820 1 Left 1194013814 X:88594734-88594756 CCAGTTAACTAAGCTTTGACAAA No data
Right 1194013820 X:88594758-88594780 TTGGAAAAATAAATGGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194013820 Original CRISPR TTGGAAAAATAAATGGGGGA AGG Intergenic
No off target data available for this crispr