ID: 1194021539

View in Genome Browser
Species Human (GRCh38)
Location X:88697256-88697278
Sequence CTGTTGGCAGGTTGGGGGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194021525_1194021539 25 Left 1194021525 X:88697208-88697230 CCAATGAGAACAACTGGACACAG No data
Right 1194021539 X:88697256-88697278 CTGTTGGCAGGTTGGGGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194021539 Original CRISPR CTGTTGGCAGGTTGGGGGCT AGG Intergenic
No off target data available for this crispr