ID: 1194023027

View in Genome Browser
Species Human (GRCh38)
Location X:88717322-88717344
Sequence ACTTGGACATTGATCATAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194023025_1194023027 -5 Left 1194023025 X:88717304-88717326 CCTTTAATGAATTAATTTACTTG No data
Right 1194023027 X:88717322-88717344 ACTTGGACATTGATCATAAATGG No data
1194023024_1194023027 9 Left 1194023024 X:88717290-88717312 CCACAATTTTGTGACCTTTAATG No data
Right 1194023027 X:88717322-88717344 ACTTGGACATTGATCATAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194023027 Original CRISPR ACTTGGACATTGATCATAAA TGG Intergenic
No off target data available for this crispr