ID: 1194024534

View in Genome Browser
Species Human (GRCh38)
Location X:88735640-88735662
Sequence CTGTGTCTGGGGAGGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194024521_1194024534 26 Left 1194024521 X:88735591-88735613 CCCAGAGGCCAAGCATCCATGCA No data
Right 1194024534 X:88735640-88735662 CTGTGTCTGGGGAGGGTGGGTGG No data
1194024525_1194024534 10 Left 1194024525 X:88735607-88735629 CCATGCAGCTGGAAACCTTCTCA No data
Right 1194024534 X:88735640-88735662 CTGTGTCTGGGGAGGGTGGGTGG No data
1194024522_1194024534 25 Left 1194024522 X:88735592-88735614 CCAGAGGCCAAGCATCCATGCAG No data
Right 1194024534 X:88735640-88735662 CTGTGTCTGGGGAGGGTGGGTGG No data
1194024524_1194024534 18 Left 1194024524 X:88735599-88735621 CCAAGCATCCATGCAGCTGGAAA No data
Right 1194024534 X:88735640-88735662 CTGTGTCTGGGGAGGGTGGGTGG No data
1194024526_1194024534 -5 Left 1194024526 X:88735622-88735644 CCTTCTCAGCGCTAAATTCTGTG No data
Right 1194024534 X:88735640-88735662 CTGTGTCTGGGGAGGGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194024534 Original CRISPR CTGTGTCTGGGGAGGGTGGG TGG Intergenic
No off target data available for this crispr