ID: 1194024592

View in Genome Browser
Species Human (GRCh38)
Location X:88736055-88736077
Sequence GTCTGGGTGTGTAGCAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194024587_1194024592 12 Left 1194024587 X:88736020-88736042 CCAGGTGACTAAGTGCTCTGAGT No data
Right 1194024592 X:88736055-88736077 GTCTGGGTGTGTAGCAAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194024592 Original CRISPR GTCTGGGTGTGTAGCAAAGA GGG Intergenic
No off target data available for this crispr