ID: 1194025600

View in Genome Browser
Species Human (GRCh38)
Location X:88746590-88746612
Sequence GCCGGCTGGCCTGCAAGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194025600_1194025602 -9 Left 1194025600 X:88746590-88746612 CCGGGGCTTGCAGGCCAGCCGGC No data
Right 1194025602 X:88746604-88746626 CCAGCCGGCCGCTCTGAGTGCGG 0: 9
1: 34
2: 168
3: 458
4: 575
1194025600_1194025607 16 Left 1194025600 X:88746590-88746612 CCGGGGCTTGCAGGCCAGCCGGC No data
Right 1194025607 X:88746629-88746651 CCCCTGAGCCCACGCCCACCCGG No data
1194025600_1194025612 28 Left 1194025600 X:88746590-88746612 CCGGGGCTTGCAGGCCAGCCGGC No data
Right 1194025612 X:88746641-88746663 CGCCCACCCGGAACTCGTGCTGG 0: 22
1: 176
2: 818
3: 725
4: 433
1194025600_1194025603 -8 Left 1194025600 X:88746590-88746612 CCGGGGCTTGCAGGCCAGCCGGC No data
Right 1194025603 X:88746605-88746627 CAGCCGGCCGCTCTGAGTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194025600 Original CRISPR GCCGGCTGGCCTGCAAGCCC CGG (reversed) Intergenic
No off target data available for this crispr