ID: 1194026193

View in Genome Browser
Species Human (GRCh38)
Location X:88753835-88753857
Sequence ATCTCATGACTGTTAATAAA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 175}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194026193_1194026195 24 Left 1194026193 X:88753835-88753857 CCATTTATTAACAGTCATGAGAT 0: 1
1: 0
2: 1
3: 11
4: 175
Right 1194026195 X:88753882-88753904 ATGTGATAGATATTTCTCTCAGG 0: 1
1: 0
2: 2
3: 17
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194026193 Original CRISPR ATCTCATGACTGTTAATAAA TGG (reversed) Exonic
901819596 1:11819048-11819070 ATCTCATAAATGTTTTTAAAAGG - Intronic
903732109 1:25504211-25504233 ATGTCCTGACTTTTAAGAAATGG + Intergenic
905559535 1:38915610-38915632 TTCTCAGGACTGTAGATAAAGGG + Exonic
908381250 1:63598943-63598965 ATCTCATGAAAGTTCAGAAAAGG - Intronic
908834151 1:68211707-68211729 ATCTCATGAGTGGTGAGAAATGG - Intronic
909555487 1:76949224-76949246 TTCTCATGAGTGTTAAGAACTGG + Intronic
909923259 1:81407582-81407604 ATCTCATGGCTTTTATTTAAGGG + Intronic
917937889 1:179886855-179886877 ATCCCATGCCTCTTAATGAAAGG + Intronic
922415103 1:225414213-225414235 ATCACATGACTGGCACTAAAAGG + Intronic
922945102 1:229507580-229507602 ATCTGATGATTGGTAATTAAAGG - Intronic
923066190 1:230519406-230519428 AGCTCATGACAGTTAACAAATGG + Intergenic
923439624 1:234004192-234004214 ATCTAATGTCTGTCAATAGAAGG + Intronic
923961641 1:239091169-239091191 ATCTTATGTATGTTAATAAGAGG - Intergenic
924371365 1:243353999-243354021 AGCACATGACTGTTGATGAAAGG + Intronic
1065152270 10:22834022-22834044 ATATCATGACTGTTTCAAAAAGG + Intergenic
1068579597 10:58724297-58724319 ATCTCATGGCTCTTTACAAAGGG + Intronic
1069345865 10:67469176-67469198 ATTTCATGAGAGTTACTAAAAGG + Intronic
1070571432 10:77642028-77642050 ATTTCATGAATGTTCAAAAAAGG + Intergenic
1073965114 10:108979760-108979782 ATCTCATATCAGTTAAGAAATGG + Intergenic
1074675246 10:115841130-115841152 ATAACATGACTGTTAATAGGAGG - Intronic
1078134964 11:8644172-8644194 ATATCATGACTGTAAATGAAAGG - Intronic
1078493046 11:11787044-11787066 ATCTCATGATTTTGTATAAATGG - Intergenic
1079193518 11:18303004-18303026 ATCCCTTCACTGATAATAAATGG + Intronic
1079415131 11:20227222-20227244 AACTCATGAAAGTTAATAAGTGG + Intergenic
1079529624 11:21434488-21434510 ATCAGATGATTGTTAATACATGG + Intronic
1080483668 11:32680158-32680180 ATTTCATGACTATCAACAAATGG + Intronic
1080955487 11:37089603-37089625 ACCTCATAATTTTTAATAAATGG + Intergenic
1081826265 11:46055981-46056003 ATTTCAAGACTTTCAATAAAAGG - Intronic
1085852562 11:80139093-80139115 CTCTCATGAGTCTTCATAAATGG - Intergenic
1086152187 11:83624194-83624216 ATCTCATTACTGTTAATGGTTGG - Intronic
1089691812 11:120191550-120191572 ATCTCTTGCCTGTTCATAGAGGG - Intergenic
1090338905 11:125997950-125997972 AAATCAATACTGTTAATAAAGGG + Intronic
1093150933 12:15620155-15620177 ATTTGCTGTCTGTTAATAAATGG - Exonic
1093563438 12:20572108-20572130 ATCTCATTACTGATTATACATGG + Intronic
1097360193 12:58651450-58651472 ATCTCATGATTTTTAAAAAAAGG + Intronic
1098773187 12:74580999-74581021 AGCTTATCACTGTTAACAAATGG + Intergenic
1100404500 12:94261919-94261941 ATTTCATTAATCTTAATAAATGG - Intronic
1105412282 13:20180591-20180613 TTCTCAGGAATGGTAATAAAAGG - Intergenic
1107389838 13:39952594-39952616 ATTTCCTGGCTGTTAATAACAGG + Intergenic
1108025829 13:46176409-46176431 ATCTCATGAATTATTATAAAAGG + Intronic
1109438472 13:62337902-62337924 AGCTATTCACTGTTAATAAAGGG - Intergenic
1111197023 13:84888290-84888312 ATCTCAGGAGTTTTAATAGATGG + Intergenic
1111268643 13:85852394-85852416 ATCACATGACTTTTTAAAAAGGG - Intergenic
1112230460 13:97584402-97584424 ATCTCATCAGTGGTAATAACAGG + Intergenic
1112664098 13:101549463-101549485 ATCTTTTGACTTTTAATAAATGG - Intronic
1114720958 14:24881569-24881591 ATATCATGACTGGCTATAAATGG - Intronic
1116016516 14:39414417-39414439 ATCACATGAGTGATAAGAAAGGG - Intronic
1116718189 14:48454911-48454933 ATCTAAGCATTGTTAATAAATGG - Intergenic
1120926364 14:89801161-89801183 ATTTCATGACTGTTCTTATATGG - Intronic
1124851840 15:33347338-33347360 ATATCATGAATGTAAATAAATGG + Intronic
1129013766 15:72447277-72447299 ATCTAATGACTGTTATGAGAAGG - Intergenic
1132390934 15:101437617-101437639 CTCTCATGACTGTTAAGCAGGGG - Intronic
1132424826 15:101706919-101706941 ATCACATATCTGTTAAGAAATGG + Intronic
1133508493 16:6434983-6435005 ATCCAAAGAATGTTAATAAATGG - Intronic
1134914182 16:18055700-18055722 ATGTTATGCCTGTTAATACAGGG - Intergenic
1138928669 16:61624317-61624339 GGCTCATGACTGTTAACTAAGGG + Intergenic
1141855353 16:86677505-86677527 ACCTGATGACTGATTATAAAGGG - Intergenic
1143961634 17:10726072-10726094 TTCTCATTTCTGATAATAAAAGG - Intronic
1146984482 17:37201780-37201802 ATATCATGAATGTTAAGAACTGG - Intronic
1147630867 17:41930624-41930646 ATCTCATGGTTGCTAAGAAACGG + Intronic
1149987242 17:61356587-61356609 TTTTCATGACTGTCAAGAAATGG - Intronic
1150597436 17:66618671-66618693 TACTCATGAATTTTAATAAAAGG + Intronic
1155442044 18:25872254-25872276 ATCTGATGAGTGTTACAAAAGGG - Intergenic
1155471985 18:26201078-26201100 ATCTCATGAATGTTTGAAAATGG - Intergenic
1155817226 18:30328150-30328172 AAATCATGCCTGTTATTAAATGG + Intergenic
1156426417 18:37018581-37018603 ATCTCAGGAATGCTAATAATTGG + Intronic
1158225177 18:55193501-55193523 ATCTCAAGAATGTTATTTAATGG - Intergenic
1158826388 18:61224923-61224945 TTCTTAGGATTGTTAATAAATGG - Intergenic
1161409576 19:4109422-4109444 AGCTGATGACTGTTTTTAAATGG - Intronic
1162254500 19:9477687-9477709 AACTCATGAATAATAATAAAAGG - Intronic
1166573476 19:43814706-43814728 ATGTCATGAATGTGAATTAAAGG + Intronic
928526947 2:32150772-32150794 ATGTTATGACTTTTAAAAAATGG - Intronic
930929521 2:56863308-56863330 AACTTATCACTGTTATTAAATGG + Intergenic
931621483 2:64214564-64214586 GTCTCATGCCTGTGAATGAATGG - Intergenic
934874384 2:97902576-97902598 ATCTCTAGACTCTTAGTAAAAGG - Intronic
935376688 2:102407302-102407324 ATCTCCAGACTGATGATAAATGG + Intergenic
938488170 2:131736923-131736945 ATTTCAGAACTGTTAACAAAAGG - Intronic
939602269 2:144207617-144207639 ATATCATTTGTGTTAATAAACGG + Intronic
940788164 2:158003784-158003806 ACCTCATGGCTTTTAATATATGG + Intronic
941384292 2:164833995-164834017 TTCCCATGACTATTTATAAAAGG - Intronic
942252008 2:174055115-174055137 AACTCATGACTGTGAGTAAAAGG - Intergenic
943764177 2:191642587-191642609 ATCAAAGGACTGTTTATAAAAGG - Intergenic
946848622 2:223883383-223883405 TTCTGTTAACTGTTAATAAATGG + Intronic
947319851 2:228904927-228904949 GTCTCAAGACTGTTAATAGCTGG - Intronic
1171077123 20:22138745-22138767 ATCTCATGATTGGGAATTAAAGG + Intergenic
1171949072 20:31405077-31405099 ATTTCATGACTGAAAACAAAAGG + Exonic
1175101161 20:56579766-56579788 TTCTCAGGAGGGTTAATAAAGGG + Intergenic
1175272539 20:57744831-57744853 ATTTTATGAGTGTTATTAAATGG + Intergenic
1179047092 21:37855780-37855802 ATCTCATGATTGTGAATATGTGG - Intronic
949215661 3:1564194-1564216 ATCACATTACTGTGAATAAAAGG - Intergenic
949243535 3:1898699-1898721 ATATCTTGACAGTGAATAAATGG + Intergenic
950446207 3:13040329-13040351 AACTCATGAATGTTAAGAATGGG - Intronic
950805142 3:15595554-15595576 ATCTCAGAACTGTTAAGAATTGG - Intronic
952506797 3:34014667-34014689 ATCTCTTGATTGTTTATTAAGGG + Intergenic
955322268 3:57982836-57982858 ATCTGGTGACTATAAATAAAGGG - Intergenic
955803538 3:62710121-62710143 TTCTCAAGACTTTTAATTAACGG - Intronic
959119423 3:102215293-102215315 ATCACATGACTTTTTGTAAAAGG + Intronic
960090375 3:113632615-113632637 ATTTCATGACTGTTTACTAAAGG - Intergenic
960105815 3:113795628-113795650 ATCTCATGTCTCATAATAGAAGG + Intronic
960747416 3:120905681-120905703 GTCTCATTGCTGTTAATAGATGG + Intergenic
961424938 3:126837646-126837668 ATTTACTGACTGGTAATAAATGG + Intronic
963797055 3:149641433-149641455 ACCTCATGTGTGTGAATAAAGGG - Intronic
964048865 3:152366866-152366888 ATCCCTTCACTGTTAATTAAGGG - Intronic
964365464 3:155946132-155946154 GTTTCATAACTATTAATAAATGG - Intergenic
965639072 3:170813904-170813926 GTCTGATGTCTGTTATTAAAGGG - Intronic
965714742 3:171590696-171590718 TTCTTTTGACTTTTAATAAAAGG + Intergenic
965718706 3:171636823-171636845 ATCTCATCACTGATCATAGAGGG + Intronic
966527203 3:180932160-180932182 ATCTCTTTACTGTTAGTTAATGG + Intronic
970446702 4:16129195-16129217 ATCTCATGCCTGTCTATCAAGGG - Intergenic
971583252 4:28370663-28370685 ATCAGATGACTCTGAATAAAGGG + Intronic
972126277 4:35770802-35770824 GTTTCATGAATATTAATAAATGG + Intergenic
973093918 4:46173475-46173497 ATCTCTTGAAAGTTAATTAATGG - Intergenic
973651258 4:52999348-52999370 ATCTGATGAGAGTTATTAAATGG - Intronic
974983079 4:68986035-68986057 ATTTCAGCACTGTTAATAAATGG - Intergenic
975602855 4:76120967-76120989 ATCACATGACTATTGACAAATGG + Intronic
976853214 4:89573186-89573208 ATGTCATGACATTTTATAAATGG - Intergenic
977464545 4:97367456-97367478 ATATCTTGACTTTTTATAAAGGG - Intronic
977612538 4:99050915-99050937 ATCTAATGTGTGTCAATAAATGG + Intronic
977695821 4:99964440-99964462 ATCTCAAGACTGATAATTAAAGG + Intergenic
977800902 4:101229976-101229998 ATCTCAATACTGGTGATAAATGG - Intronic
978977482 4:114896079-114896101 ATCCCATGAATGTGAATATATGG - Intronic
979280789 4:118865309-118865331 ATGTCATGTCTGTCAATAGATGG - Intronic
979831625 4:125312416-125312438 ATATCATGCATGTTAAAAAATGG - Intergenic
979896685 4:126166571-126166593 GTCTCAAAACTGCTAATAAAGGG + Intergenic
979951950 4:126904086-126904108 ATCTCATAGCTGTGAAGAAAAGG - Intergenic
981193007 4:141885438-141885460 AACTCATGACTAATAATAAGAGG + Intergenic
981218495 4:142202228-142202250 ATCTCATTTCTATTATTAAATGG - Intronic
981693845 4:147539401-147539423 AGCTAATGACTCTTAATAACAGG - Intronic
982847318 4:160270396-160270418 ATCTCACAACTGTTTATAAGTGG + Intergenic
983343035 4:166490499-166490521 ATCACATGACTGTTCAGAGAGGG - Intergenic
987566778 5:19599537-19599559 AGCTGATGACTATTAATAACTGG - Intronic
987827020 5:23045233-23045255 TTCTCCTGACTCTTATTAAATGG + Intergenic
988383148 5:30525866-30525888 ATCTCTTGGCTCTTAACAAATGG - Intergenic
990229560 5:53697368-53697390 ATTTCATGTATGTCAATAAAAGG - Intergenic
992246562 5:74830328-74830350 AGATCATGACTAGTAATAAAAGG - Intronic
994932731 5:106209581-106209603 ATCTCAAGACTTTTAAAAATTGG - Intergenic
998140207 5:139695719-139695741 CTCTCATAACTTTTAATAAGAGG - Intergenic
1000697754 5:164409813-164409835 CTCTCATGACTGATAATACCAGG - Intergenic
1004757081 6:18622128-18622150 ATCTCATGTCTTTTTATAACTGG + Intergenic
1005105405 6:22219434-22219456 TTCTCATGAGGGTTAATTAATGG - Intergenic
1005436582 6:25818247-25818269 AACTCATGATTTTTCATAAAAGG - Intronic
1005458378 6:26043731-26043753 ATCTCAGGACTATAAATACATGG - Intergenic
1008951816 6:57170094-57170116 TCATCATGACTGTTAAGAAAAGG + Exonic
1010435379 6:75823879-75823901 ATCTAATGACTCTTAATAAATGG + Intronic
1010942757 6:81938289-81938311 ATTTCATGACAGTATATAAAAGG + Intergenic
1011993543 6:93555332-93555354 CTCTCATGACTATTAAAAAAGGG - Intergenic
1012528920 6:100211078-100211100 ATCTCATTAATGTTAAGCAAGGG + Intergenic
1012929385 6:105301104-105301126 ATCTCATGACTGGCGATAATGGG - Intronic
1015246669 6:131082374-131082396 CTCTTTTGACTGTTAACAAAAGG + Intergenic
1015716233 6:136195128-136195150 AATTCATCACTGTTATTAAAAGG - Exonic
1018159769 6:161027794-161027816 ATACCATGACAGCTAATAAATGG - Intronic
1019865242 7:3702626-3702648 ATCTCATCACTGCTAATTCAGGG - Intronic
1020510491 7:9050184-9050206 AACTCATTACTGTTAGGAAAAGG - Intergenic
1020862154 7:13507320-13507342 ATTTCAAGACTATTAATAGACGG - Intergenic
1023298670 7:38744122-38744144 ATCTCATGAGGGTTATTGAAAGG - Intronic
1023393903 7:39734641-39734663 AACACATGGCTTTTAATAAATGG + Intergenic
1027396820 7:77764953-77764975 TTCTCATGAGAGTTAATAATAGG + Intronic
1027936393 7:84609224-84609246 ATCTCTTGACTATTCATAGAAGG - Intergenic
1035939425 8:3880241-3880263 TTCTCATGAATGTTAAGAGAAGG - Intronic
1036413183 8:8521609-8521631 ATCCCATCACTGTTGTTAAATGG - Intergenic
1036674208 8:10816354-10816376 CCCTCATGACTATTAATCAAGGG + Intronic
1037340221 8:17836581-17836603 ATCTCATGTCTTCTAACAAAAGG + Intergenic
1038915879 8:32022134-32022156 ATCTCACGACTGTTATTTATGGG + Intronic
1044132922 8:88548865-88548887 ATTTCATGAATCTGAATAAATGG - Intergenic
1045467166 8:102480959-102480981 ATCTGATGACAACTAATAAAGGG - Intergenic
1045999567 8:108402970-108402992 ATCTCATGACATTTTAGAAAAGG + Intronic
1050269090 9:3923114-3923136 ATCTAAAGACTGTTGATTAATGG + Intronic
1051413865 9:16818544-16818566 AGCTCATGATTCATAATAAATGG + Intronic
1054095655 9:60899027-60899049 ATCCCTTGACTTTTTATAAACGG + Intergenic
1054590639 9:67007602-67007624 ATCTCTTGACTTTTTATGAACGG - Intergenic
1054773483 9:69104874-69104896 ATCTTTGGACTGTTAACAAATGG + Intergenic
1055396125 9:75876928-75876950 ATCTCAAGATTCTTAATAAAGGG + Intergenic
1055885135 9:81053326-81053348 ATCTTATGGCTCTTCATAAATGG - Intergenic
1056208787 9:84345042-84345064 ATCTCAGCACTGTTTCTAAATGG - Intergenic
1059181580 9:112218451-112218473 ATGTCATGACATTTATTAAAAGG + Exonic
1062131287 9:134894861-134894883 TTCTCATTATTGTTTATAAAAGG + Intergenic
1188629181 X:32330080-32330102 TTCTCTTGGCTGTTACTAAATGG + Intronic
1188629681 X:32338824-32338846 ATCTGATGACTGCCAAGAAAGGG - Intronic
1190503552 X:51102803-51102825 ATCTGAAGACTGTGATTAAAAGG + Intergenic
1193929741 X:87538438-87538460 GTTTTATGTCTGTTAATAAAAGG - Intronic
1194026193 X:88753835-88753857 ATCTCATGACTGTTAATAAATGG - Exonic
1194088059 X:89553063-89553085 TTCTCATGGCTCTTACTAAAAGG - Intergenic
1194561466 X:95427377-95427399 AACTAATGACTGCCAATAAAGGG + Intergenic
1195659061 X:107360699-107360721 ATCTCCTGACAGTCAAAAAAGGG - Intergenic
1195876232 X:109544879-109544901 ATCTCAGGAATGTGAATAATTGG - Intergenic
1199501147 X:148507616-148507638 TTATCATGACTGTTAAACAAAGG + Intronic
1200308715 X:155055271-155055293 ATCTCATGGCTGTTTCCAAAGGG + Exonic
1200440560 Y:3207717-3207739 TTCTCATGGCTCTTACTAAAAGG + Intergenic