ID: 1194031460

View in Genome Browser
Species Human (GRCh38)
Location X:88821350-88821372
Sequence TGGCCTTATATGAGTTAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194031457_1194031460 2 Left 1194031457 X:88821325-88821347 CCAAGTTTTGATATCTGGATAAT No data
Right 1194031460 X:88821350-88821372 TGGCCTTATATGAGTTAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194031460 Original CRISPR TGGCCTTATATGAGTTAAGG AGG Intergenic
No off target data available for this crispr