ID: 1194033286

View in Genome Browser
Species Human (GRCh38)
Location X:88841285-88841307
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194033282_1194033286 27 Left 1194033282 X:88841235-88841257 CCAAGATCATCAAGGATCAAGGC No data
Right 1194033286 X:88841285-88841307 CAGCATTATTGGTCCTGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194033286 Original CRISPR CAGCATTATTGGTCCTGGTG TGG Intergenic
No off target data available for this crispr