ID: 1194042039

View in Genome Browser
Species Human (GRCh38)
Location X:88952901-88952923
Sequence ATGTTCTGCTTCAAAAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194042036_1194042039 2 Left 1194042036 X:88952876-88952898 CCTCTCCTGACTTTTAAAAATTT No data
Right 1194042039 X:88952901-88952923 ATGTTCTGCTTCAAAAGTGAAGG No data
1194042035_1194042039 14 Left 1194042035 X:88952864-88952886 CCTTGCTCACTTCCTCTCCTGAC No data
Right 1194042039 X:88952901-88952923 ATGTTCTGCTTCAAAAGTGAAGG No data
1194042034_1194042039 18 Left 1194042034 X:88952860-88952882 CCAACCTTGCTCACTTCCTCTCC No data
Right 1194042039 X:88952901-88952923 ATGTTCTGCTTCAAAAGTGAAGG No data
1194042037_1194042039 -3 Left 1194042037 X:88952881-88952903 CCTGACTTTTAAAAATTTCCATG No data
Right 1194042039 X:88952901-88952923 ATGTTCTGCTTCAAAAGTGAAGG No data
1194042032_1194042039 20 Left 1194042032 X:88952858-88952880 CCCCAACCTTGCTCACTTCCTCT No data
Right 1194042039 X:88952901-88952923 ATGTTCTGCTTCAAAAGTGAAGG No data
1194042033_1194042039 19 Left 1194042033 X:88952859-88952881 CCCAACCTTGCTCACTTCCTCTC No data
Right 1194042039 X:88952901-88952923 ATGTTCTGCTTCAAAAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194042039 Original CRISPR ATGTTCTGCTTCAAAAGTGA AGG Intergenic
No off target data available for this crispr