ID: 1194043730

View in Genome Browser
Species Human (GRCh38)
Location X:88974412-88974434
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194043728_1194043730 -10 Left 1194043728 X:88974399-88974421 CCTTTGAGAGGGTATCGACTGAG No data
Right 1194043730 X:88974412-88974434 ATCGACTGAGAGGTGACATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194043730 Original CRISPR ATCGACTGAGAGGTGACATG AGG Intergenic