ID: 1194044253

View in Genome Browser
Species Human (GRCh38)
Location X:88982431-88982453
Sequence CCTGCCTCGCGGCTGGTCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194044253_1194044263 1 Left 1194044253 X:88982431-88982453 CCCCCGACCAGCCGCGAGGCAGG No data
Right 1194044263 X:88982455-88982477 GCGTGGGCTCTGCCTACCGTGGG No data
1194044253_1194044262 0 Left 1194044253 X:88982431-88982453 CCCCCGACCAGCCGCGAGGCAGG No data
Right 1194044262 X:88982454-88982476 AGCGTGGGCTCTGCCTACCGTGG No data
1194044253_1194044269 14 Left 1194044253 X:88982431-88982453 CCCCCGACCAGCCGCGAGGCAGG No data
Right 1194044269 X:88982468-88982490 CTACCGTGGGGGCGCACCAGGGG No data
1194044253_1194044264 2 Left 1194044253 X:88982431-88982453 CCCCCGACCAGCCGCGAGGCAGG No data
Right 1194044264 X:88982456-88982478 CGTGGGCTCTGCCTACCGTGGGG No data
1194044253_1194044265 3 Left 1194044253 X:88982431-88982453 CCCCCGACCAGCCGCGAGGCAGG No data
Right 1194044265 X:88982457-88982479 GTGGGCTCTGCCTACCGTGGGGG No data
1194044253_1194044266 12 Left 1194044253 X:88982431-88982453 CCCCCGACCAGCCGCGAGGCAGG No data
Right 1194044266 X:88982466-88982488 GCCTACCGTGGGGGCGCACCAGG No data
1194044253_1194044268 13 Left 1194044253 X:88982431-88982453 CCCCCGACCAGCCGCGAGGCAGG No data
Right 1194044268 X:88982467-88982489 CCTACCGTGGGGGCGCACCAGGG No data
1194044253_1194044271 18 Left 1194044253 X:88982431-88982453 CCCCCGACCAGCCGCGAGGCAGG No data
Right 1194044271 X:88982472-88982494 CGTGGGGGCGCACCAGGGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194044253 Original CRISPR CCTGCCTCGCGGCTGGTCGG GGG (reversed) Intergenic
No off target data available for this crispr