ID: 1194045025

View in Genome Browser
Species Human (GRCh38)
Location X:88991926-88991948
Sequence GGGAACACTCTCTCTTCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194045017_1194045025 13 Left 1194045017 X:88991890-88991912 CCTATCTCTATGTGGGGCTCCCT No data
Right 1194045025 X:88991926-88991948 GGGAACACTCTCTCTTCTCATGG No data
1194045022_1194045025 -6 Left 1194045022 X:88991909-88991931 CCCTCTGCTCCATATGGGGGAAC No data
Right 1194045025 X:88991926-88991948 GGGAACACTCTCTCTTCTCATGG No data
1194045013_1194045025 25 Left 1194045013 X:88991878-88991900 CCTGTATAGGAACCTATCTCTAT No data
Right 1194045025 X:88991926-88991948 GGGAACACTCTCTCTTCTCATGG No data
1194045023_1194045025 -7 Left 1194045023 X:88991910-88991932 CCTCTGCTCCATATGGGGGAACA No data
Right 1194045025 X:88991926-88991948 GGGAACACTCTCTCTTCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194045025 Original CRISPR GGGAACACTCTCTCTTCTCA TGG Intergenic
No off target data available for this crispr