ID: 1194050023

View in Genome Browser
Species Human (GRCh38)
Location X:89056634-89056656
Sequence GAGGCTCTATTTGTGCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194050020_1194050023 7 Left 1194050020 X:89056604-89056626 CCGATCGATGGGAGTTGTGAGAC No data
Right 1194050023 X:89056634-89056656 GAGGCTCTATTTGTGCTGCCTGG No data
1194050019_1194050023 17 Left 1194050019 X:89056594-89056616 CCAAAATTTACCGATCGATGGGA No data
Right 1194050023 X:89056634-89056656 GAGGCTCTATTTGTGCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194050023 Original CRISPR GAGGCTCTATTTGTGCTGCC TGG Intergenic
No off target data available for this crispr