ID: 1194051727

View in Genome Browser
Species Human (GRCh38)
Location X:89077839-89077861
Sequence GTGGAGTTCTTCAGGGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194051719_1194051727 16 Left 1194051719 X:89077800-89077822 CCAGTTTTTAAGTTTCTTAATTG 0: 23
1: 35
2: 25
3: 68
4: 636
Right 1194051727 X:89077839-89077861 GTGGAGTTCTTCAGGGAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194051727 Original CRISPR GTGGAGTTCTTCAGGGAACA GGG Intergenic
No off target data available for this crispr