ID: 1194058885

View in Genome Browser
Species Human (GRCh38)
Location X:89172327-89172349
Sequence CTGCTTTGTTTTAGCAATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194058885_1194058889 -10 Left 1194058885 X:89172327-89172349 CCAGCATTGCTAAAACAAAGCAG No data
Right 1194058889 X:89172340-89172362 AACAAAGCAGGTGGAAAAAAGGG No data
1194058885_1194058890 -9 Left 1194058885 X:89172327-89172349 CCAGCATTGCTAAAACAAAGCAG No data
Right 1194058890 X:89172341-89172363 ACAAAGCAGGTGGAAAAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194058885 Original CRISPR CTGCTTTGTTTTAGCAATGC TGG (reversed) Intergenic
No off target data available for this crispr