ID: 1194062669

View in Genome Browser
Species Human (GRCh38)
Location X:89223660-89223682
Sequence AAATGTCTCAAAAGGGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194062665_1194062669 19 Left 1194062665 X:89223618-89223640 CCAGAGTGGCTGGAGTTTAGACA No data
Right 1194062669 X:89223660-89223682 AAATGTCTCAAAAGGGAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194062669 Original CRISPR AAATGTCTCAAAAGGGAAGT AGG Intergenic
No off target data available for this crispr