ID: 1194064096

View in Genome Browser
Species Human (GRCh38)
Location X:89240894-89240916
Sequence CAAAATGCTGATAGTGATAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194064092_1194064096 4 Left 1194064092 X:89240867-89240889 CCTAGAGACTTGTCGAATGGCTT 0: 21
1: 1493
2: 1912
3: 1413
4: 823
Right 1194064096 X:89240894-89240916 CAAAATGCTGATAGTGATAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194064096 Original CRISPR CAAAATGCTGATAGTGATAG GGG Intergenic
No off target data available for this crispr