ID: 1194067439

View in Genome Browser
Species Human (GRCh38)
Location X:89278785-89278807
Sequence TTATCTCTCTAGCAATATTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194067439_1194067441 3 Left 1194067439 X:89278785-89278807 CCCTAATATTGCTAGAGAGATAA No data
Right 1194067441 X:89278811-89278833 TCCAGATACAAAAAATTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194067439 Original CRISPR TTATCTCTCTAGCAATATTA GGG (reversed) Intergenic
No off target data available for this crispr